DNASU Plasmid Repository • 480.965.5697 | Email

MX1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MX1
Gene Name:  myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH031002.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00000101

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1989nts         Open reading frame : 1 to 1989
Reference Sequence Alignment

ATGGTTGTTTCCGAAGTGGACATCGCAAAAGCTGATCCAGCTGCTGCATCCCACCCTCTA
TTACTGAATGGAGATGCTACTGTGGCCCAGAAAAATCCAGGCTCGGTGGCTGAGAACAAC
CTGTGCAGCCAGTATGAGGAGAAGGTGCGCCCCTGCATCGACCTCATTGACTCCCTGCGG
GCTCTAGGTGTGGAGCAGGACCTGGCCCTGCCAGCCATCGCCGTCATCGGGGACCAGAGC
TCGGGCAAGAGCTCCGTGTTGGAGGCACTGTCAGGAGTTGCCCTTCCCAGAGGCAGCGGG
ATCGTGACCAGATGCCCGCTGGTGCTGAAACTGAAGAAACTTGTGAACGAAGATAAGTGG
AGAGGCAAGGTCAGTTACCAGGACTACGAGATTGAGATTTCGGATGCTTCAGAGGTAGAA
AAGGAAATTAATAAAGCCCAGAATGCCATCGCCGGGGAAGGAATGGGAATCAGTCATGAG
CTAATCACCCTGGAGATCAGCTCCCGAGATGTCCCGGATCTGACTCTAATAGACCTTCCT
GGCATAACCAGAGTGGCTGTGGGCAATCAGCCTGCTGACATTGGGTATAAGATCAAGACA
CTCATCAAGAAGTACATCCAGAGGCAGGAGACAATCAGCCTGGTGGTGGTCCCCAGTAAT
GTGGACATCGCCACCACAGAGGCTCTCAGCATGGCCCAGGAGGTGGACCCCGAGGGAGAC
AGGACCATCGGAATCTTGACGAAGCCTGATCTGGTGGACAAAGGAACTGAAGACAAGGTT
GTGGACGTGGTGCGGAACCTCGTGTTCCACCTGAAGAAGGGTTACATGATTGTCAAGTGC
CGGGGCCAGCAGGAGATCCAGGACCAGCTGAGCCTGTCCGAAGCCCTGCAGAGAGAGAAG
ATCTTCTTTGAGAACCACCCATATTTCAGGGATCTGCTGGAGGAAGGAAAGGCCACGGTT
CCCTGCCTGGCAGAAAAACTTACCAGCGAGCTCATCACACATATCTGTAAATCTCTGCCC
CTGTTAGAAAATCAAATCAAGGAGACTCACCAGAGAATAACAGAGGAGCTACAAAAGTAT
GGTGTCGACATACCGGAAGACGAAAATGAAAAAATGTTCTTCCTGATAGATAAAGTTAAT
GCCTTTAATCAGGACATCACTGCTCTCATGCAAGGAGAGGAAACTGTAGGGGAGGAAGAC
ATTCGGCTGTTTACCAGACTCCGACACGAGTTCCACAAATGGAGTACAATAATTGAAAAC
AATTTTCAAGAAGGCCATAAAATTTTGAGTAGAAAAATCCAGAAATTTGAAAATCAGTAT
CGTGGTAGAGAGCTGCCAGGCTTTGTGAATTACAGGACATTTGAGACAATCGTGAAACAG
CAAATCAAGGCACTGGAAGAGCCGGCTGTGGATATGCTACACACCGTGACGGATATGGTC
CGGCTTGCTTTCACAGATGTTTCGATAAAAAATTTTGAAGAGTTTTTTAACCTCCACAGA
ACCGCCAAGTCCAAAATTGAAGACATTAGAGCAGAACAAGAGAGAGAAGGTGAGAAGCTG
ATCCGCCTCCACTTCCAGATGGAACAGATTGTCTACTGCCAGGACCAGGTATACAGGGGT
GCGTTGCAGAAGGTCAGAGAGAAGGAGCTGGAAGAAGAAAAGAAGAAGAAATCCTGGGAT
TTTGGGGCTTTCCAGTCCAGCTCGGCAACAGACTCTTCCATGGAGGAGATCTTTCAGCAC
CTGATGGCCTATCACCAGGAGGCCAGCAAGCGCATCTCCAGCCACATCCCTTTGATCATC
CAGTTCTTCATGCTCCAGACGTACGGCCAGCAGCTTCAGAAGGCCATGCTGCAGCTCCTG
CAGGACAAGGACACCTACAGCTGGCTCCTGAAGGAGCGGAGCGACACCAGCGACAAGCGG
AAGTTCCTGAAGGAGCGGCTTGCACGGCTGACGCAGGCTCGGCGCCGGCTTGCCCAGTTC
CCCGGTTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2334
Start on reference sequence 346
Mutations:
None
Discrepancy:
a1135g,I379V; a1623g
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MX1
Symbol Nomenclature : MX1
SYNONYM : IFI-78K; IFI78; MX; MxA
Designation : interferon-induced GTP-binding protein Mx1|interferon-induced protein p78|interferon-regulated resistance GTP-binding protein MxA|myxoma resistance protein 1
Full Nomenclature : myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)
GENEID : 4599
GI : 61354936
GenBank Accession : AY888131
HGNC : 7532
MIM : 147150
Vega : OTTHUMG00000086755
Target GenBank: NM_002462

 

Reference Sequence Alignment

  

HsCD00000101        ATGGTTGTTTCCGAAGTGGACATCGCAAAAGCTGATCCAGCTGCTGCATCCCACCCTCTA
NM_001144925.2      ATGGTTGTTTCCGAAGTGGACATCGCAAAAGCTGATCCAGCTGCTGCATCCCACCCTCTA
XM_005260981.1      ATGGTTGTTTCCGAAGTGGACATCGCAAAAGCTGATCCAGCTGCTGCATCCCACCCTCTA
XM_005260982.1      ATGGTTGTTTCCGAAGTGGACATCGCAAAAGCTGATCCAGCTGCTGCATCCCACCCTCTA
NM_001178046.2      ATGGTTGTTTCCGAAGTGGACATCGCAAAAGCTGATCCAGCTGCTGCATCCCACCCTCTA
XM_005260980.1      ATGGTTGTTTCCGAAGTGGACATCGCAAAAGCTGATCCAGCTGCTGCATCCCACCCTCTA
XM_005260979.1      ATGGTTGTTTCCGAAGTGGACATCGCAAAAGCTGATCCAGCTGCTGCATCCCACCCTCTA
NM_002462.4         ATGGTTGTTTCCGAAGTGGACATCGCAAAAGCTGATCCAGCTGCTGCATCCCACCCTCTA
                    ************************************************************

HsCD00000101        TTACTGAATGGAGATGCTACTGTGGCCCAGAAAAATCCAGGCTCGGTGGCTGAGAACAAC
NM_001144925.2      TTACTGAATGGAGATGCTACTGTGGCCCAGAAAAATCCAGGCTCGGTGGCTGAGAACAAC
XM_005260981.1      TTACTGAATGGAGATGCTACTGTGGCCCAGAAAAATCCAGGCTCGGTGGCTGAGAACAAC
XM_005260982.1      TTACTGAATGGAGATGCTACTGTGGCCCAGAAAAATCCAGGCTCGGTGGCTGAGAACAAC
NM_001178046.2      TTACTGAATGGAGATGCTACTGTGGCCCAGAAAAATCCAGGCTCGGTGGCTGAGAACAAC
XM_005260980.1      TTACTGAATGGAGATGCTACTGTGGCCCAGAAAAATCCAGGCTCGGTGGCTGAGAACAAC
XM_005260979.1      TTACTGAATGGAGATGCTACTGTGGCCCAGAAAAATCCAGGCTCGGTGGCTGAGAACAAC
NM_002462.4         TTACTGAATGGAGATGCTACTGTGGCCCAGAAAAATCCAGGCTCGGTGGCTGAGAACAAC
                    ************************************************************

HsCD00000101        CTGTGCAGCCAGTATGAGGAGAAGGTGCGCCCCTGCATCGACCTCATTGACTCCCTGCGG
NM_001144925.2      CTGTGCAGCCAGTATGAGGAGAAGGTGCGCCCCTGCATCGACCTCATTGACTCCCTGCGG
XM_005260981.1      CTGTGCAGCCAGTATGAGGAGAAGGTGCGCCCCTGCATCGACCTCATTGACTCCCTGCGG
XM_005260982.1      CTGTGCAGCCAGTATGAGGAGAAGGTGCGCCCCTGCATCGACCTCATTGACTCCCTGCGG
NM_001178046.2      CTGTGCAGCCAGTATGAGGAGAAGGTGCGCCCCTGCATCGACCTCATTGACTCCCTGCGG
XM_005260980.1      CTGTGCAGCCAGTATGAGGAGAAGGTGCGCCCCTGCATCGACCTCATTGACTCCCTGCGG
XM_005260979.1      CTGTGCAGCCAGTATGAGGAGAAGGTGCGCCCCTGCATCGACCTCATTGACTCCCTGCGG
NM_002462.4         CTGTGCAGCCAGTATGAGGAGAAGGTGCGCCCCTGCATCGACCTCATTGACTCCCTGCGG
                    ************************************************************

HsCD00000101        GCTCTAGGTGTGGAGCAGGACCTGGCCCTGCCAGCCATCGCCGTCATCGGGGACCAGAGC
NM_001144925.2      GCTCTAGGTGTGGAGCAGGACCTGGCCCTGCCAGCCATCGCCGTCATCGGGGACCAGAGC
XM_005260981.1      GCTCTAGGTGTGGAGCAGGACCTGGCCCTGCCAGCCATCGCCGTCATCGGGGACCAGAGC
XM_005260982.1      GCTCTAGGTGTGGAGCAGGACCTGGCCCTGCCAGCCATCGCCGTCATCGGGGACCAGAGC
NM_001178046.2      GCTCTAGGTGTGGAGCAGGACCTGGCCCTGCCAGCCATCGCCGTCATCGGGGACCAGAGC
XM_005260980.1      GCTCTAGGTGTGGAGCAGGACCTGGCCCTGCCAGCCATCGCCGTCATCGGGGACCAGAGC
XM_005260979.1      GCTCTAGGTGTGGAGCAGGACCTGGCCCTGCCAGCCATCGCCGTCATCGGGGACCAGAGC
NM_002462.4         GCTCTAGGTGTGGAGCAGGACCTGGCCCTGCCAGCCATCGCCGTCATCGGGGACCAGAGC
                    ************************************************************

HsCD00000101        TCGGGCAAGAGCTCCGTGTTGGAGGCACTGTCAGGAGTTGCCCTTCCCAGAGGCAGCGGG
NM_001144925.2      TCGGGCAAGAGCTCCGTGTTGGAGGCACTGTCAGGAGTTGCCCTTCCCAGAGGCAGCGGG
XM_005260981.1      TCGGGCAAGAGCTCCGTGTTGGAGGCACTGTCAGGAGTTGCCCTTCCCAGAGGCAGCGGG
XM_005260982.1      TCGGGCAAGAGCTCCGTGTTGGAGGCACTGTCAGGAGTTGCCCTTCCCAGAGGCAGCGGG
NM_001178046.2      TCGGGCAAGAGCTCCGTGTTGGAGGCACTGTCAGGAGTTGCCCTTCCCAGAGGCAGCGGG
XM_005260980.1      TCGGGCAAGAGCTCCGTGTTGGAGGCACTGTCAGGAGTTGCCCTTCCCAGAGGCAGCGGG
XM_005260979.1      TCGGGCAAGAGCTCCGTGTTGGAGGCACTGTCAGGAGTTGCCCTTCCCAGAGGCAGCGGG
NM_002462.4         TCGGGCAAGAGCTCCGTGTTGGAGGCACTGTCAGGAGTTGCCCTTCCCAGAGGCAGCGGG
                    ************************************************************

HsCD00000101        ATCGTGACCAGATGCCCGCTGGTGCTGAAACTGAAGAAACTTGTGAACGAAGATAAGTGG
NM_001144925.2      ATCGTGACCAGATGCCCGCTGGTGCTGAAACTGAAGAAACTTGTGAACGAAGATAAGTGG
XM_005260981.1      ATCGTGACCAGATGCCCGCTGGTGCTGAAACTGAAGAAACTTGTGAACGAAGATAAGTGG
XM_005260982.1      ATCGTGACCAGATGCCCGCTGGTGCTGAAACTGAAGAAACTTGTGAACGAAGATAAGTGG
NM_001178046.2      ATCGTGACCAGATGCCCGCTGGTGCTGAAACTGAAGAAACTTGTGAACGAAGATAAGTGG
XM_005260980.1      ATCGTGACCAGATGCCCGCTGGTGCTGAAACTGAAGAAACTTGTGAACGAAGATAAGTGG
XM_005260979.1      ATCGTGACCAGATGCCCGCTGGTGCTGAAACTGAAGAAACTTGTGAACGAAGATAAGTGG
NM_002462.4         ATCGTGACCAGATGCCCGCTGGTGCTGAAACTGAAGAAACTTGTGAACGAAGATAAGTGG
                    ************************************************************

HsCD00000101        AGAGGCAAGGTCAGTTACCAGGACTACGAGATTGAGATTTCGGATGCTTCAGAGGTAGAA
NM_001144925.2      AGAGGCAAGGTCAGTTACCAGGACTACGAGATTGAGATTTCGGATGCTTCAGAGGTAGAA
XM_005260981.1      AGAGGCAAGGTCAGTTACCAGGACTACGAGATTGAGATTTCGGATGCTTCAGAGGTAGAA
XM_005260982.1      AGAGGCAAGGTCAGTTACCAGGACTACGAGATTGAGATTTCGGATGCTTCAGAGGTAGAA
NM_001178046.2      AGAGGCAAGGTCAGTTACCAGGACTACGAGATTGAGATTTCGGATGCTTCAGAGGTAGAA
XM_005260980.1      AGAGGCAAGGTCAGTTACCAGGACTACGAGATTGAGATTTCGGATGCTTCAGAGGTAGAA
XM_005260979.1      AGAGGCAAGGTCAGTTACCAGGACTACGAGATTGAGATTTCGGATGCTTCAGAGGTAGAA
NM_002462.4         AGAGGCAAGGTCAGTTACCAGGACTACGAGATTGAGATTTCGGATGCTTCAGAGGTAGAA
                    ************************************************************

HsCD00000101        AAGGAAATTAATAAAGCCCAGAATGCCATCGCCGGGGAAGGAATGGGAATCAGTCATGAG
NM_001144925.2      AAGGAAATTAATAAAGCCCAGAATGCCATCGCCGGGGAAGGAATGGGAATCAGTCATGAG
XM_005260981.1      AAGGAAATTAATAAAGCCCAGAATGCCATCGCCGGGGAAGGAATGGGAATCAGTCATGAG
XM_005260982.1      AAGGAAATTAATAAAGCCCAGAATGCCATCGCCGGGGAAGGAATGGGAATCAGTCATGAG
NM_001178046.2      AAGGAAATTAATAAAGCCCAGAATGCCATCGCCGGGGAAGGAATGGGAATCAGTCATGAG
XM_005260980.1      AAGGAAATTAATAAAGCCCAGAATGCCATCGCCGGGGAAGGAATGGGAATCAGTCATGAG
XM_005260979.1      AAGGAAATTAATAAAGCCCAGAATGCCATCGCCGGGGAAGGAATGGGAATCAGTCATGAG
NM_002462.4         AAGGAAATTAATAAAGCCCAGAATGCCATCGCCGGGGAAGGAATGGGAATCAGTCATGAG
                    ************************************************************

HsCD00000101        CTAATCACCCTGGAGATCAGCTCCCGAGATGTCCCGGATCTGACTCTAATAGACCTTCCT
NM_001144925.2      CTAATCACCCTGGAGATCAGCTCCCGAGATGTCCCGGATCTGACTCTAATAGACCTTCCT
XM_005260981.1      CTAATCACCCTGGAGATCAGCTCCCGAGATGTCCCGGATCTGACTCTAATAGACCTTCCT
XM_005260982.1      CTAATCACCCTGGAGATCAGCTCCCGAGATGTCCCGGATCTGACTCTAATAGACCTTCCT
NM_001178046.2      CTAATCACCCTGGAGATCAGCTCCCGAGATGTCCCGGATCTGACTCTAATAGACCTTCCT
XM_005260980.1      CTAATCACCCTGGAGATCAGCTCCCGAGATGTCCCGGATCTGACTCTAATAGACCTTCCT
XM_005260979.1      CTAATCACCCTGGAGATCAGCTCCCGAGATGTCCCGGATCTGACTCTAATAGACCTTCCT
NM_002462.4         CTAATCACCCTGGAGATCAGCTCCCGAGATGTCCCGGATCTGACTCTAATAGACCTTCCT
                    ************************************************************

HsCD00000101        GGCATAACCAGAGTGGCTGTGGGCAATCAGCCTGCTGACATTGGGTATAAGATCAAGACA
NM_001144925.2      GGCATAACCAGAGTGGCTGTGGGCAATCAGCCTGCTGACATTGGGTATAAGATCAAGACA
XM_005260981.1      GGCATAACCAGAGTGGCTGTGGGCAATCAGCCTGCTGACATTGGGTATAAGATCAAGACA
XM_005260982.1      GGCATAACCAGAGTGGCTGTGGGCAATCAGCCTGCTGACATTGGGTATAAGATCAAGACA
NM_001178046.2      GGCATAACCAGAGTGGCTGTGGGCAATCAGCCTGCTGACATTGGGTATAAGATCAAGACA
XM_005260980.1      GGCATAACCAGAGTGGCTGTGGGCAATCAGCCTGCTGACATTGGGTATAAGATCAAGACA
XM_005260979.1      GGCATAACCAGAGTGGCTGTGGGCAATCAGCCTGCTGACATTGGGTATAAGATCAAGACA
NM_002462.4         GGCATAACCAGAGTGGCTGTGGGCAATCAGCCTGCTGACATTGGGTATAAGATCAAGACA
                    ************************************************************

HsCD00000101        CTCATCAAGAAGTACATCCAGAGGCAGGAGACAATCAGCCTGGTGGTGGTCCCCAGTAAT
NM_001144925.2      CTCATCAAGAAGTACATCCAGAGGCAGGAGACAATCAGCCTGGTGGTGGTCCCCAGTAAT
XM_005260981.1      CTCATCAAGAAGTACATCCAGAGGCAGGAGACAATCAGCCTGGTGGTGGTCCCCAGTAAT
XM_005260982.1      CTCATCAAGAAGTACATCCAGAGGCAGGAGACAATCAGCCTGGTGGTGGTCCCCAGTAAT
NM_001178046.2      CTCATCAAGAAGTACATCCAGAGGCAGGAGACAATCAGCCTGGTGGTGGTCCCCAGTAAT
XM_005260980.1      CTCATCAAGAAGTACATCCAGAGGCAGGAGACAATCAGCCTGGTGGTGGTCCCCAGTAAT
XM_005260979.1      CTCATCAAGAAGTACATCCAGAGGCAGGAGACAATCAGCCTGGTGGTGGTCCCCAGTAAT
NM_002462.4         CTCATCAAGAAGTACATCCAGAGGCAGGAGACAATCAGCCTGGTGGTGGTCCCCAGTAAT
                    ************************************************************

HsCD00000101        GTGGACATCGCCACCACAGAGGCTCTCAGCATGGCCCAGGAGGTGGACCCCGAGGGAGAC
NM_001144925.2      GTGGACATCGCCACCACAGAGGCTCTCAGCATGGCCCAGGAGGTGGACCCCGAGGGAGAC
XM_005260981.1      GTGGACATCGCCACCACAGAGGCTCTCAGCATGGCCCAGGAGGTGGACCCCGAGGGAGAC
XM_005260982.1      GTGGACATCGCCACCACAGAGGCTCTCAGCATGGCCCAGGAGGTGGACCCCGAGGGAGAC
NM_001178046.2      GTGGACATCGCCACCACAGAGGCTCTCAGCATGGCCCAGGAGGTGGACCCCGAGGGAGAC
XM_005260980.1      GTGGACATCGCCACCACAGAGGCTCTCAGCATGGCCCAGGAGGTGGACCCCGAGGGAGAC
XM_005260979.1      GTGGACATCGCCACCACAGAGGCTCTCAGCATGGCCCAGGAGGTGGACCCCGAGGGAGAC
NM_002462.4         GTGGACATCGCCACCACAGAGGCTCTCAGCATGGCCCAGGAGGTGGACCCCGAGGGAGAC
                    ************************************************************

HsCD00000101        AGGACCATCGGAATCTTGACGAAGCCTGATCTGGTGGACAAAGGAACTGAAGACAAGGTT
NM_001144925.2      AGGACCATCGGAATCTTGACGAAGCCTGATCTGGTGGACAAAGGAACTGAAGACAAGGTT
XM_005260981.1      AGGACCATCGGAATCTTGACGAAGCCTGATCTGGTGGACAAAGGAACTGAAGACAAGGTT
XM_005260982.1      AGGACCATCGGAATCTTGACGAAGCCTGATCTGGTGGACAAAGGAACTGAAGACAAGGTT
NM_001178046.2      AGGACCATCGGAATCTTGACGAAGCCTGATCTGGTGGACAAAGGAACTGAAGACAAGGTT
XM_005260980.1      AGGACCATCGGAATCTTGACGAAGCCTGATCTGGTGGACAAAGGAACTGAAGACAAGGTT
XM_005260979.1      AGGACCATCGGAATCTTGACGAAGCCTGATCTGGTGGACAAAGGAACTGAAGACAAGGTT
NM_002462.4         AGGACCATCGGAATCTTGACGAAGCCTGATCTGGTGGACAAAGGAACTGAAGACAAGGTT
                    ************************************************************

HsCD00000101        GTGGACGTGGTGCGGAACCTCGTGTTCCACCTGAAGAAGGGTTACATGATTGTCAAGTGC
NM_001144925.2      GTGGACGTGGTGCGGAACCTCGTGTTCCACCTGAAGAAGGGTTACATGATTGTCAAGTGC
XM_005260981.1      GTGGACGTGGTGCGGAACCTCGTGTTCCACCTGAAGAAGGGTTACATGATTGTCAAGTGC
XM_005260982.1      GTGGACGTGGTGCGGAACCTCGTGTTCCACCTGAAGAAGGGTTACATGATTGTCAAGTGC
NM_001178046.2      GTGGACGTGGTGCGGAACCTCGTGTTCCACCTGAAGAAGGGTTACATGATTGTCAAGTGC
XM_005260980.1      GTGGACGTGGTGCGGAACCTCGTGTTCCACCTGAAGAAGGGTTACATGATTGTCAAGTGC
XM_005260979.1      GTGGACGTGGTGCGGAACCTCGTGTTCCACCTGAAGAAGGGTTACATGATTGTCAAGTGC
NM_002462.4         GTGGACGTGGTGCGGAACCTCGTGTTCCACCTGAAGAAGGGTTACATGATTGTCAAGTGC
                    ************************************************************

HsCD00000101        CGGGGCCAGCAGGAGATCCAGGACCAGCTGAGCCTGTCCGAAGCCCTGCAGAGAGAGAAG
NM_001144925.2      CGGGGCCAGCAGGAGATCCAGGACCAGCTGAGCCTGTCCGAAGCCCTGCAGAGAGAGAAG
XM_005260981.1      CGGGGCCAGCAGGAGATCCAGGACCAGCTGAGCCTGTCCGAAGCCCTGCAGAGAGAGAAG
XM_005260982.1      CGGGGCCAGCAGGAGATCCAGGACCAGCTGAGCCTGTCCGAAGCCCTGCAGAGAGAGAAG
NM_001178046.2      CGGGGCCAGCAGGAGATCCAGGACCAGCTGAGCCTGTCCGAAGCCCTGCAGAGAGAGAAG
XM_005260980.1      CGGGGCCAGCAGGAGATCCAGGACCAGCTGAGCCTGTCCGAAGCCCTGCAGAGAGAGAAG
XM_005260979.1      CGGGGCCAGCAGGAGATCCAGGACCAGCTGAGCCTGTCCGAAGCCCTGCAGAGAGAGAAG
NM_002462.4         CGGGGCCAGCAGGAGATCCAGGACCAGCTGAGCCTGTCCGAAGCCCTGCAGAGAGAGAAG
                    ************************************************************

HsCD00000101        ATCTTCTTTGAGAACCACCCATATTTCAGGGATCTGCTGGAGGAAGGAAAGGCCACGGTT
NM_001144925.2      ATCTTCTTTGAGAACCACCCATATTTCAGGGATCTGCTGGAGGAAGGAAAGGCCACGGTT
XM_005260981.1      ATCTTCTTTGAGAACCACCCATATTTCAGGGATCTGCTGGAGGAAGGAAAGGCCACGGTT
XM_005260982.1      ATCTTCTTTGAGAACCACCCATATTTCAGGGATCTGCTGGAGGAAGGAAAGGCCACGGTT
NM_001178046.2      ATCTTCTTTGAGAACCACCCATATTTCAGGGATCTGCTGGAGGAAGGAAAGGCCACGGTT
XM_005260980.1      ATCTTCTTTGAGAACCACCCATATTTCAGGGATCTGCTGGAGGAAGGAAAGGCCACGGTT
XM_005260979.1      ATCTTCTTTGAGAACCACCCATATTTCAGGGATCTGCTGGAGGAAGGAAAGGCCACGGTT
NM_002462.4         ATCTTCTTTGAGAACCACCCATATTTCAGGGATCTGCTGGAGGAAGGAAAGGCCACGGTT
                    ************************************************************

HsCD00000101        CCCTGCCTGGCAGAAAAACTTACCAGCGAGCTCATCACACATATCTGTAAATCTCTGCCC
NM_001144925.2      CCCTGCCTGGCAGAAAAACTTACCAGCGAGCTCATCACACATATCTGTAAATCTCTGCCC
XM_005260981.1      CCCTGCCTGGCAGAAAAACTTACCAGCGAGCTCATCACACATATCTGTAAATCTCTGCCC
XM_005260982.1      CCCTGCCTGGCAGAAAAACTTACCAGCGAGCTCATCACACATATCTGTAAATCTCTGCCC
NM_001178046.2      CCCTGCCTGGCAGAAAAACTTACCAGCGAGCTCATCACACATATCTGTAAATCTCTGCCC
XM_005260980.1      CCCTGCCTGGCAGAAAAACTTACCAGCGAGCTCATCACACATATCTGTAAATCTCTGCCC
XM_005260979.1      CCCTGCCTGGCAGAAAAACTTACCAGCGAGCTCATCACACATATCTGTAAATCTCTGCCC
NM_002462.4         CCCTGCCTGGCAGAAAAACTTACCAGCGAGCTCATCACACATATCTGTAAATCTCTGCCC
                    ************************************************************

HsCD00000101        CTGTTAGAAAATCAAATCAAGGAGACTCACCAGAGAATAACAGAGGAGCTACAAAAGTAT
NM_001144925.2      CTGTTAGAAAATCAAATCAAGGAGACTCACCAGAGAATAACAGAGGAGCTACAAAAGTAT
XM_005260981.1      CTGTTAGAAAATCAAATCAAGGAGACTCACCAGAGAATAACAGAGGAGCTACAAAAGTAT
XM_005260982.1      CTGTTAGAAAATCAAATCAAGGAGACTCACCAGAGAATAACAGAGGAGCTACAAAAGTAT
NM_001178046.2      CTGTTAGAAAATCAAATCAAGGAGACTCACCAGAGAATAACAGAGGAGCTACAAAAGTAT
XM_005260980.1      CTGTTAGAAAATCAAATCAAGGAGACTCACCAGAGAATAACAGAGGAGCTACAAAAGTAT
XM_005260979.1      CTGTTAGAAAATCAAATCAAGGAGACTCACCAGAGAATAACAGAGGAGCTACAAAAGTAT
NM_002462.4         CTGTTAGAAAATCAAATCAAGGAGACTCACCAGAGAATAACAGAGGAGCTACAAAAGTAT
                    ************************************************************

HsCD00000101        GGTGTCGACATACCGGAAGACGAAAATGAAAAAATGTTCTTCCTGATAGATAAAGTTAAT
NM_001144925.2      GGTGTCGACATACCGGAAGACGAAAATGAAAAAATGTTCTTCCTGATAGATAAAGTTAAT
XM_005260981.1      GGTGTCGACATACCGGAAGACGAAAATGAAAAAATGTTCTTCCTGATAGATAAAGTTAAT
XM_005260982.1      GGTGTCGACATACCGGAAGACGAAAATGAAAAAATGTTCTTCCTGATAGATAAAGTTAAT
NM_001178046.2      GGTGTCGACATACCGGAAGACGAAAATGAAAAAATGTTCTTCCTGATAGATAAAGTTAAT
XM_005260980.1      GGTGTCGACATACCGGAAGACGAAAATGAAAAAATGTTCTTCCTGATAGATAAAGTTAAT
XM_005260979.1      GGTGTCGACATACCGGAAGACGAAAATGAAAAAATGTTCTTCCTGATAGATAAAGTTAAT
NM_002462.4         GGTGTCGACATACCGGAAGACGAAAATGAAAAAATGTTCTTCCTGATAGATAAAGTTAAT
                    ************************************************************

HsCD00000101        GCCTTTAATCAGGACATCACTGCTCTCATGCAAGGAGAGGAAACTGTAGGGGAGGAAGAC
NM_001144925.2      GCCTTTAATCAGGACATCACTGCTCTCATGCAAGGAGAGGAAACTGTAGGGGAGGAAGAC
XM_005260981.1      GCCTTTAATCAGGACATCACTGCTCTCATGCAAGGAGAGGAAACTGTAGGGGAGGAAGAC
XM_005260982.1      GCCTTTAATCAGGACATCACTGCTCTCATGCAAGGAGAGGAAACTGTAGGGGAGGAAGAC
NM_001178046.2      GCCTTTAATCAGGACATCACTGCTCTCATGCAAGGAGAGGAAACTGTAGGGGAGGAAGAC
XM_005260980.1      GCCTTTAATCAGGACATCACTGCTCTCATGCAAGGAGAGGAAACTGTAGGGGAGGAAGAC
XM_005260979.1      GCCTTTAATCAGGACATCACTGCTCTCATGCAAGGAGAGGAAACTGTAGGGGAGGAAGAC
NM_002462.4         GCCTTTAATCAGGACATCACTGCTCTCATGCAAGGAGAGGAAACTGTAGGGGAGGAAGAC
                    ************************************************************

HsCD00000101        ATTCGGCTGTTTACCAGACTCCGACACGAGTTCCACAAATGGAGTACAATAATTGAAAAC
NM_001144925.2      ATTCGGCTGTTTACCAGACTCCGACACGAGTTCCACAAATGGAGTACAATAATTGAAAAC
XM_005260981.1      ATTCGGCTGTTTACCAGACTCCGACACGAGTTCCACAAATGGAGTACAATAATTGAAAAC
XM_005260982.1      ATTCGGCTGTTTACCAGACTCCGACACGAGTTCCACAAATGGAGTACAATAATTGAAAAC
NM_001178046.2      ATTCGGCTGTTTACCAGACTCCGACACGAGTTCCACAAATGGAGTACAATAATTGAAAAC
XM_005260980.1      ATTCGGCTGTTTACCAGACTCCGACACGAGTTCCACAAATGGAGTACAATAATTGAAAAC
XM_005260979.1      ATTCGGCTGTTTACCAGACTCCGACACGAGTTCCACAAATGGAGTACAATAATTGAAAAC
NM_002462.4         ATTCGGCTGTTTACCAGACTCCGACACGAGTTCCACAAATGGAGTACAATAATTGAAAAC
                    ************************************************************

HsCD00000101        AATTTTCAAGAAGGCCATAAAATTTTGAGTAGAAAAATCCAGAAATTTGAAAATCAGTAT
NM_001144925.2      AATTTTCAAGAAGGCCATAAAATTTTGAGTAGAAAAATCCAGAAATTTGAAAATCAGTAT
XM_005260981.1      AATTTTCAAGAAGGCCATAAAATTTTGAGTAGAAAAATCCAGAAATTTGAAAATCAGTAT
XM_005260982.1      AATTTTCAAGAAGGCCATAAAATTTTGAGTAGAAAAATCCAGAAATTTGAAAATCAGTAT
NM_001178046.2      AATTTTCAAGAAGGCCATAAAATTTTGAGTAGAAAAATCCAGAAATTTGAAAATCAGTAT
XM_005260980.1      AATTTTCAAGAAGGCCATAAAATTTTGAGTAGAAAAATCCAGAAATTTGAAAATCAGTAT
XM_005260979.1      AATTTTCAAGAAGGCCATAAAATTTTGAGTAGAAAAATCCAGAAATTTGAAAATCAGTAT
NM_002462.4         AATTTTCAAGAAGGCCATAAAATTTTGAGTAGAAAAATCCAGAAATTTGAAAATCAGTAT
                    ************************************************************

HsCD00000101        CGTGGTAGAGAGCTGCCAGGCTTTGTGAATTACAGGACATTTGAGACAATCGTGAAACAG
NM_001144925.2      CGTGGTAGAGAGCTGCCAGGCTTTGTGAATTACAGGACATTTGAGACAATCGTGAAACAG
XM_005260981.1      CGTGGTAGAGAGCTGCCAGGCTTTGTGAATTACAGGACATTTGAGACAATCGTGAAACAG
XM_005260982.1      CGTGGTAGAGAGCTGCCAGGCTTTGTGAATTACAGGACATTTGAGACAATCGTGAAACAG
NM_001178046.2      CGTGGTAGAGAGCTGCCAGGCTTTGTGAATTACAGGACATTTGAGACAATCGTGAAACAG
XM_005260980.1      CGTGGTAGAGAGCTGCCAGGCTTTGTGAATTACAGGACATTTGAGACAATCGTGAAACAG
XM_005260979.1      CGTGGTAGAGAGCTGCCAGGCTTTGTGAATTACAGGACATTTGAGACAATCGTGAAACAG
NM_002462.4         CGTGGTAGAGAGCTGCCAGGCTTTGTGAATTACAGGACATTTGAGACAATCGTGAAACAG
                    ************************************************************

HsCD00000101        CAAATCAAGGCACTGGAAGAGCCGGCTGTGGATATGCTACACACCGTGACGGATATGGTC
NM_001144925.2      CAAATCAAGGCACTGGAAGAGCCGGCTGTGGATATGCTACACACCGTGACGGATATGGTC
XM_005260981.1      CAAATCAAGGCACTGGAAGAGCCGGCTGTGGATATGCTACACACCGTGACGGATATGGTC
XM_005260982.1      CAAATCAAGGCACTGGAAGAGCCGGCTGTGGATATGCTACACACCGTGACGGATATGGTC
NM_001178046.2      CAAATCAAGGCACTGGAAGAGCCGGCTGTGGATATGCTACACACCGTGACGGATATGGTC
XM_005260980.1      CAAATCAAGGCACTGGAAGAGCCGGCTGTGGATATGCTACACACCGTGACGGATATGGTC
XM_005260979.1      CAAATCAAGGCACTGGAAGAGCCGGCTGTGGATATGCTACACACCGTGACGGATATGGTC
NM_002462.4         CAAATCAAGGCACTGGAAGAGCCGGCTGTGGATATGCTACACACCGTGACGGATATGGTC
                    ************************************************************

HsCD00000101        CGGCTTGCTTTCACAGATGTTTCGATAAAAAATTTTGAAGAGTTTTTTAACCTCCACAGA
NM_001144925.2      CGGCTTGCTTTCACAGATGTTTCGATAAAAAATTTTGAAGAGTTTTTTAACCTCCACAGA
XM_005260981.1      CGGCTTGCTTTCACAGATGTTTCGATAAAAAATTTTGAAGAGTTTTTTAACCTCCACAGA
XM_005260982.1      CGGCTTGCTTTCACAGATGTTTCGATAAAAAATTTTGAAGAGTTTTTTAACCTCCACAGA
NM_001178046.2      CGGCTTGCTTTCACAGATGTTTCGATAAAAAATTTTGAAGAGTTTTTTAACCTCCACAGA
XM_005260980.1      CGGCTTGCTTTCACAGATGTTTCGATAAAAAATTTTGAAGAGTTTTTTAACCTCCACAGA
XM_005260979.1      CGGCTTGCTTTCACAGATGTTTCGATAAAAAATTTTGAAGAGTTTTTTAACCTCCACAGA
NM_002462.4         CGGCTTGCTTTCACAGATGTTTCGATAAAAAATTTTGAAGAGTTTTTTAACCTCCACAGA
                    ************************************************************

HsCD00000101        ACCGCCAAGTCCAAAATTGAAGACATTAGAGCAGAACAAGAGAGAGAAGGTGAGAAGCTG
NM_001144925.2      ACCGCCAAGTCCAAAATTGAAGACATTAGAGCAGAACAAGAGAGAGAAGGTGAGAAGCTG
XM_005260981.1      ACCGCCAAGTCCAAAATTGAAGACATTAGAGCAGAACAAGAGAGAGAAGGTGAGAAGCTG
XM_005260982.1      ACCGCCAAGTCCAAAATTGAAGACATTAGAGCAGAACAAGAGAGAGAAGGTGAGAAGCTG
NM_001178046.2      ACCGCCAAGTCCAAAATTGAAGACATTAGAGCAGAACAAGAGAGAGAAGGTGAGAAGCTG
XM_005260980.1      ACCGCCAAGTCCAAAATTGAAGACATTAGAGCAGAACAAGAGAGAGAAGGTGAGAAGCTG
XM_005260979.1      ACCGCCAAGTCCAAAATTGAAGACATTAGAGCAGAACAAGAGAGAGAAGGTGAGAAGCTG
NM_002462.4         ACCGCCAAGTCCAAAATTGAAGACATTAGAGCAGAACAAGAGAGAGAAGGTGAGAAGCTG
                    ************************************************************

HsCD00000101        ATCCGCCTCCACTTCCAGATGGAACAGATTGTCTACTGCCAGGACCAGGTATACAGGGGT
NM_001144925.2      ATCCGCCTCCACTTCCAGATGGAACAGATTGTCTACTGCCAGGACCAGGTATACAGGGGT
XM_005260981.1      ATCCGCCTCCACTTCCAGATGGAACAGATTGTCTACTGCCAGGACCAGGTATACAGGGGT
XM_005260982.1      ATCCGCCTCCACTTCCAGATGGAACAGATTGTCTACTGCCAGGACCAGGTATACAGGGGT
NM_001178046.2      ATCCGCCTCCACTTCCAGATGGAACAGATTGTCTACTGCCAGGACCAGGTATACAGGGGT
XM_005260980.1      ATCCGCCTCCACTTCCAGATGGAACAGATTGTCTACTGCCAGGACCAGGTATACAGGGGT
XM_005260979.1      ATCCGCCTCCACTTCCAGATGGAACAGATTGTCTACTGCCAGGACCAGGTATACAGGGGT
NM_002462.4         ATCCGCCTCCACTTCCAGATGGAACAGATTGTCTACTGCCAGGACCAGGTATACAGGGGT
                    ************************************************************

HsCD00000101        GCGTTGCAGAAGGTCAGAGAGAAGGAGCTGGAAGAAGAAAAGAAGAAGAAATCCTGGGAT
NM_001144925.2      GCATTGCAGAAGGTCAGAGAGAAGGAGCTGGAAGAAGAAAAGAAGAAGAAATCCTGGGAT
XM_005260981.1      GCATTGCAGAAGGTCAGAGAGAAGGAGCTGGAAGAAGAAAAGAAGAAGAAATCCTGGGAT
XM_005260982.1      GCATTGCAGAAGGTCAGAGAGAAGGAGCTGGAAGAAGAAAAGAAGAAGAAATCCTGGGAT
NM_001178046.2      GCATTGCAGAAGGTCAGAGAGAAGGAGCTGGAAGAAGAAAAGAAGAAGAAATCCTGGGAT
XM_005260980.1      GCATTGCAGAAGGTCAGAGAGAAGGAGCTGGAAGAAGAAAAGAAGAAGAAATCCTGGGAT
XM_005260979.1      GCATTGCAGAAGGTCAGAGAGAAGGAGCTGGAAGAAGAAAAGAAGAAGAAATCCTGGGAT
NM_002462.4         GCATTGCAGAAGGTCAGAGAGAAGGAGCTGGAAGAAGAAAAGAAGAAGAAATCCTGGGAT
                    **.*********************************************************

HsCD00000101        TTTGGGGCTTTCCAGTCCAGCTCGGCAACAGACTCTTCCATGGAGGAGATCTTTCAGCAC
NM_001144925.2      TTTGGGGCTTTCCAGTCCAGCTCGGCAACAGACTCTTCCATGGAGGAGATCTTTCAGCAC
XM_005260981.1      TTTGGGGCTTTCCAGTCCAGCTCGGCAACAGACTCTTCCATGGAGGAGATCTTTCAGCAC
XM_005260982.1      TTTGGGGCTTTCCAGTCCAGCTCGGCAACAGACTCTTCCATGGAGGAGATCTTTCAGCAC
NM_001178046.2      TTTGGGGCTTTCCAGTCCAGCTCGGCAACAGACTCTTCCATGGAGGAGATCTTTCAGCAC
XM_005260980.1      TTTGGGGCTTTCCAGTCCAGCTCGGCAACAGACTCTTCCATGGAGGAGATCTTTCAGCAC
XM_005260979.1      TTTGGGGCTTTCCAGTCCAGCTCGGCAACAGACTCTTCCATGGAGGAGATCTTTCAGCAC
NM_002462.4         TTTGGGGCTTTCCAGTCCAGCTCGGCAACAGACTCTTCCATGGAGGAGATCTTTCAGCAC
                    ************************************************************

HsCD00000101        CTGATGGCCTATCACCAGGAGGCCAGCAAGCGCATCTCCAGCCACATCCCTTTGATCATC
NM_001144925.2      CTGATGGCCTATCACCAGGAGGCCAGCAAGCGCATCTCCAGCCACATCCCTTTGATCATC
XM_005260981.1      CTGATGGCCTATCACCAGGAGGCCAGCAAGCGCATCTCCAGCCACATCCCTTTGATCATC
XM_005260982.1      CTGATGGCCTATCACCAGGAGGCCAGCAAGCGCATCTCCAGCCACATCCCTTTGATCATC
NM_001178046.2      CTGATGGCCTATCACCAGGAGGCCAGCAAGCGCATCTCCAGCCACATCCCTTTGATCATC
XM_005260980.1      CTGATGGCCTATCACCAGGAGGCCAGCAAGCGCATCTCCAGCCACATCCCTTTGATCATC
XM_005260979.1      CTGATGGCCTATCACCAGGAGGCCAGCAAGCGCATCTCCAGCCACATCCCTTTGATCATC
NM_002462.4         CTGATGGCCTATCACCAGGAGGCCAGCAAGCGCATCTCCAGCCACATCCCTTTGATCATC
                    ************************************************************

HsCD00000101        CAGTTCTTCATGCTCCAGACGTACGGCCAGCAGCTTCAGAAGGCCATGCTGCAGCTCCTG
NM_001144925.2      CAGTTCTTCATGCTCCAGACGTACGGCCAGCAGCTTCAGAAGGCCATGCTGCAGCTCCTG
XM_005260981.1      CAGTTCTTCATGCTCCAGACGTACGGCCAGCAGCTTCAGAAGGCCATGCTGCAGCTCCTG
XM_005260982.1      CAGTTCTTCATGCTCCAGACGTACGGCCAGCAGCTTCAGAAGGCCATGCTGCAGCTCCTG
NM_001178046.2      CAGTTCTTCATGCTCCAGACGTACGGCCAGCAGCTTCAGAAGGCCATGCTGCAGCTCCTG
XM_005260980.1      CAGTTCTTCATGCTCCAGACGTACGGCCAGCAGCTTCAGAAGGCCATGCTGCAGCTCCTG
XM_005260979.1      CAGTTCTTCATGCTCCAGACGTACGGCCAGCAGCTTCAGAAGGCCATGCTGCAGCTCCTG
NM_002462.4         CAGTTCTTCATGCTCCAGACGTACGGCCAGCAGCTTCAGAAGGCCATGCTGCAGCTCCTG
                    ************************************************************

HsCD00000101        CAGGACAAGGACACCTACAGCTGGCTCCTGAAGGAGCGGAGCGACACCAGCGACAAGCGG
NM_001144925.2      CAGGACAAGGACACCTACAGCTGGCTCCTGAAGGAGCGGAGCGACACCAGCGACAAGCGG
XM_005260981.1      CAGGACAAGGACACCTACAGCTGGCTCCTGAAGGAGCGGAGCGACACCAGCGACAAGCGG
XM_005260982.1      CAGGACAAGGACACCTACAGCTGGCTCCTGAAGGAGCGGAGCGACACCAGCGACAAGCGG
NM_001178046.2      CAGGACAAGGACACCTACAGCTGGCTCCTGAAGGAGCGGAGCGACACCAGCGACAAGCGG
XM_005260980.1      CAGGACAAGGACACCTACAGCTGGCTCCTGAAGGAGCGGAGCGACACCAGCGACAAGCGG
XM_005260979.1      CAGGACAAGGACACCTACAGCTGGCTCCTGAAGGAGCGGAGCGACACCAGCGACAAGCGG
NM_002462.4         CAGGACAAGGACACCTACAGCTGGCTCCTGAAGGAGCGGAGCGACACCAGCGACAAGCGG
                    ************************************************************

HsCD00000101        AAGTTCCTGAAGGAGCGGCTTGCACGGCTGACGCAGGCTCGGCGCCGGCTTGCCCAGTTC
NM_001144925.2      AAGTTCCTGAAGGAGCGGCTTGCACGGCTGACGCAGGCTCGGCGCCGGCTTGCCCAGTTC
XM_005260981.1      AAGTTCCTGAAGGAGCGGCTTGCACGGCTGACGCAGGCTCGGCGCCGGCTTGCCCAGTTC
XM_005260982.1      AAGTTCCTGAAGGAGCGGCTTGCACGGCTGACGCAGGCTCGGCGCCGGCTTGCCCAGTTC
NM_001178046.2      AAGTTCCTGAAGGAGCGGCTTGCACGGCTGACGCAGGCTCGGCGCCGGCTTGCCCAGTTC
XM_005260980.1      AAGTTCCTGAAGGAGCGGCTTGCACGGCTGACGCAGGCTCGGCGCCGGCTTGCCCAGTTC
XM_005260979.1      AAGTTCCTGAAGGAGCGGCTTGCACGGCTGACGCAGGCTCGGCGCCGGCTTGCCCAGTTC
NM_002462.4         AAGTTCCTGAAGGAGCGGCTTGCACGGCTGACGCAGGCTCGGCGCCGGCTTGCCCAGTTC
                    ************************************************************

HsCD00000101        CCCGGTTAG
NM_001144925.2      CCCGGTTAA
XM_005260981.1      CCCGGTTAA
XM_005260982.1      CCCGGTTAA
NM_001178046.2      CCCGGTTAA
XM_005260980.1      CCCGGTTAA
XM_005260979.1      CCCGGTTAA
NM_002462.4         CCCGGTTAA
                    ********.

Pathways

Reactome : Antiviral mechanism by IFN-stimulated genes
Reactome : Cytokine Signaling in Immune system
Reactome : ISG15 antiviral mechanism
Reactome : Immune System
Reactome : Interferon Signaling
Reactome : Interferon alpha/beta signaling

Protein

SMART domain : GED : Dynamin GTPase effector domain
SMART domain : DYNc : Dynamin, GTPase
UniProt : B2RDA5
UniProt : B3KU10
UniProt : P20591
HPRD : 00919

Clone

Cloning Information : 31002
HIP Master Clone ID : 61378
Original Clone ID : FLH031002.01X

Organism


TAX_ID : 9606
Species Specific ID: 4599

Genome

Chromosome : 21
Map Location : 21q22.3
Ensembl : ENSG00000157601

Reagents

Labome : MxA-antibody