DNASU Plasmid Repository • 480.965.5697 | Email

EREG (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  EREG
Gene Name:  epiregulin
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH130858.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00000103

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 510nts         Open reading frame : 1 to 510
Reference Sequence Alignment

ATGACCGCGGGGAGGAGGATGGAGATGCTCTGTGCCGGCAGGGTCCCTGCGCTGCTGCTC
TGCCTGGGTTTCCATCTTCTACAGGCAGTCCTCAGTACAACTGTGATTCCATCATGTATC
CCAGGAGAGTCCAGTGATAACTGCACAGCTTTAGTTCAGACAGAAGACAATCCACGTGTG
GCTCAAGTGTCAATAACAAAGTGTAGCTCTGACATGAATGGCTATTGTTTGCATGGACAG
TGCATCTATCTGGTGGACATGAGTCAAAACTACTGCAGGTGTGAAGTGGGTTATACTGGT
GTCCGATGTGAACACTTCTTTTTAACCGTCCACCAACCTTTAAGCAAAGAGTATGTGGCT
TTGACCGTGATTCTTATTATTTTGTTTCTTATCACAGTCGTCGGTTCCACATATTATTTC
TGCAGATGGTACAGAAATCGAAAAAGTAAAGAACCAAAGAAGGAATATGAGAGAGTTACC
TCAGGGGATCCAGAGTTGCCGCAAGTCGAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 676
Start on reference sequence 167
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : EREG
Symbol Nomenclature : EREG
SYNONYM : ER
Designation : proepiregulin
Full Nomenclature : epiregulin
GENEID : 2069
GI : 60825081
GenBank Accession : AY893669
HGNC : 3443
MIM : 602061
Vega : OTTHUMG00000130005
Target GenBank: NM_001432

 

Reference Sequence Alignment

  

HsCD00000103      ATGACCGCGGGGAGGAGGATGGAGATGCTCTGTGCCGGCAGGGTCCCTGCGCTGCTGCTC
NM_001432.2       ATGACCGCGGGGAGGAGGATGGAGATGCTCTGTGCCGGCAGGGTCCCTGCGCTGCTGCTC
                  ************************************************************

HsCD00000103      TGCCTGGGTTTCCATCTTCTACAGGCAGTCCTCAGTACAACTGTGATTCCATCATGTATC
NM_001432.2       TGCCTGGGTTTCCATCTTCTACAGGCAGTCCTCAGTACAACTGTGATTCCATCATGTATC
                  ************************************************************

HsCD00000103      CCAGGAGAGTCCAGTGATAACTGCACAGCTTTAGTTCAGACAGAAGACAATCCACGTGTG
NM_001432.2       CCAGGAGAGTCCAGTGATAACTGCACAGCTTTAGTTCAGACAGAAGACAATCCACGTGTG
                  ************************************************************

HsCD00000103      GCTCAAGTGTCAATAACAAAGTGTAGCTCTGACATGAATGGCTATTGTTTGCATGGACAG
NM_001432.2       GCTCAAGTGTCAATAACAAAGTGTAGCTCTGACATGAATGGCTATTGTTTGCATGGACAG
                  ************************************************************

HsCD00000103      TGCATCTATCTGGTGGACATGAGTCAAAACTACTGCAGGTGTGAAGTGGGTTATACTGGT
NM_001432.2       TGCATCTATCTGGTGGACATGAGTCAAAACTACTGCAGGTGTGAAGTGGGTTATACTGGT
                  ************************************************************

HsCD00000103      GTCCGATGTGAACACTTCTTTTTAACCGTCCACCAACCTTTAAGCAAAGAGTATGTGGCT
NM_001432.2       GTCCGATGTGAACACTTCTTTTTAACCGTCCACCAACCTTTAAGCAAAGAATATGTGGCT
                  **************************************************.*********

HsCD00000103      TTGACCGTGATTCTTATTATTTTGTTTCTTATCACAGTCGTCGGTTCCACATATTATTTC
NM_001432.2       TTGACCGTGATTCTTATTATTTTGTTTCTTATCACAGTCGTCGGTTCCACATATTATTTC
                  ************************************************************

HsCD00000103      TGCAGATGGTACAGAAATCGAAAAAGTAAAGAACCAAAGAAGGAATATGAGAGAGTTACC
NM_001432.2       TGCAGATGGTACAGAAATCGAAAAAGTAAAGAACCAAAGAAGGAATATGAGAGAGTTACC
                  ************************************************************

HsCD00000103      TCAGGGGATCCAGAGTTGCCGCAAGTCGAC
NM_001432.2       TCAGGGGATCCAGAGTTGCCGCAAGTCTGA
                  *************************** ..

Pathways

NCI : ErbB receptor signaling network
NCI : ErbB4 signaling events
Panther : EGF receptor signaling pathway
Reactome : Adaptive Immune System
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : GRB2 events in ERBB2 signaling
Reactome : Immune System
Reactome : Innate Immune System
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Nuclear signaling by ERBB4
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : SHC1 events in ERBB2 signaling
Reactome : SHC1 events in ERBB4 signaling
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
WikiPathway : ErbB signaling pathway

Protein

SMART domain : EGF : Epidermal growth factor-like domain.
UniProt : O14944
UniProt : B2RC66
HPRD : 03638

Clone

Cloning Information : 130858
HIP Master Clone ID : 107015
Original Clone ID : FLH130858.01L

Organism


TAX_ID : 9606
Species Specific ID: 2069

Genome

Chromosome : 4
Map Location : 4q13.3
Ensembl : ENSG00000124882

Reagents

Labome : EREG-antibody