DNASU Plasmid Repository • 480.965.5697 | Email

ETS1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ETS1
Gene Name:  v-ets avian erythroblastosis virus E26 oncogene homolog 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH008825.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00001052

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1326nts        
Open reading frame : 1 to 1326
Reference Sequence Alignment

ATGAAGGCGGCCGTCGATCTCAAGCCGACTCTCACCATCATCAAGACGGAAAAAGTCGAT
CTGGAGCTTTTCCCCTCCCCGGATATGGAATGTGCAGATGTCCCACTATTAACTCCAAGC
AGCAAAGAAATGATGTCTCAAGCATTAAAAGCTACTTTCAGTGGTTTCACTAAAGAACAG
CAACGACTGGGGATCCCAAAAGACCCCCGGCAGTGGACAGAAACCCATGTTCGGGACTGG
GTGATGTGGGCTGTGAATGAATTCAGCCTGAAAGGTGTAGACTTCCAGAAGTTCTGTATG
AATGGAGCAGCCCTCTGCGCCCTGGGTAAAGACTGCTTTCTCGAGCTGGCCCCAGACTTT
GTTGGGGACATCTTATGGGAACATCTAGAGATCCTGCAGAAAGAGGATGTGAAACCATAT
CAAGTTAATGGAGTCAACCCAGCCTATCCAGAATCCCGCTATACCTCGGATTACTTCATT
AGCTATGGTATTGAGCATGCCCAGTGTGTTCCACCATCGGAGTTCTCAGAGCCCAGCTTC
ATCACAGAGTCCTATCAGACGCTCCATCCCATCAGCTCGGAAGAGCTCCTCTCCCTCAAG
TATGAGAATGACTACCCCTCGGTCATTCTCCGAGACCCTCTCCAGACAGACACCTTGCAG
AATGACTACTTTGCTATCAAACAAGAAGTCTTCACCCCAGACAACATGTGCATGGGGAGG
ACCAGTCGTGGTAAACTCGGGGGCCAGGACTCTTTTGAAAGCATAGAGAGCTACGATAGT
TGTGATCGCCTCACCCAGTCCTGGAGCAGCCAGTCATCTTTCAACAGCCTGCAGCGTGTT
CCCTCCTATGACAGCTTCGACTCAGAGGACTATCCGGCTGCCCTGCCCAACCACAAGCCC
AAGGGCACCTTCAAGGACTATGTGCGGGACCGTGCTGACCTCAATAAGGACAAGCCTGTC
ATTCCTGCTGCTGCCCTAGCTGGCTACACAGGCAGTGGACCAATCCAGCTATGGCAGTTT
CTTCTGGAATTACTCACTGATAAATCCTGTCAGTCTTTTATCAGCTGGACAGGAGATGGC
TGGGAATTCAAACTTTCTGACCCAGATGAGGTGGCCAGGAGATGGGGAAAGAGGAAAAAC
AAACCTAAGATGAATTATGAGAAACTGAGCCGTGGCCTACGCTACTATTACGACAAAAAC
ATCATCCACAAGACAGCGGGGAAACGCTACGTGTACCGCTTTGTGTGTGACCTGCAGAGC
CTGCTGGGGTACACCCCTGAGGAGCTGCACGCCATGCTGGACGTCAAGCCAGATGCCGAC
GAGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1604
Start on reference sequence 279
Mutations:
None
Discrepancy:
g691t,V231F
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 9 42
recombination site loxP site loxP recombination site 1015 1048
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ETS1
Symbol Nomenclature : ETS1
SYNONYM : ETS-1; EWSR2
Designation : Avian erythroblastosis virus E26 (v-ets) oncogene homolog-1|ets protein|p54|protein C-ets-1|v-ets avian erythroblastosis virus E2 oncogene homolog 1
Full Nomenclature : v-ets avian erythroblastosis virus E26 oncogene homolog 1
GENEID : 2113
GI : 61357899
GenBank Accession : AY888523
HGNC : 3488
MIM : 164720
Vega : OTTHUMG00000165799
Target GenBank: NM_005238

 

Reference Sequence Alignment

  

HsCD00001052        ------------------------------------------------------------
NM_001143820.1      ATGAGCTACTTTGTGGATTCTGCTGGGAGCAGCCCCGTCCCTTACTCAGCGCCTCGTCCT
XM_005271428.1      ------------------------------------------------------------
NM_005238.3         ------------------------------------------------------------
                                                                                

HsCD00001052        ------------------------------------------------------ATGAAG
NM_001143820.1      GCAGTGGTGAGGCAAGGACCTAGCAACACTTATGAAGATCCTCGAATGAACTGTGGTTTC
XM_005271428.1      ------------------------------------------------------------
NM_005238.3         ------------------------------------------------------ATGAAG
                                                                                

HsCD00001052        GCGGCCGTCGATCTCAAGCCGACTCTCACCATCATCAAGACGGAAAAAGTCGATCTGGAG
NM_001143820.1      CAGTCCAATTATCACCAGCAAAGACCTTGCTACCCCTTTTGGGATGAGATGGCAACTCAG
XM_005271428.1      ------------------------------------------------------------
NM_005238.3         GCGGCCGTCGATCTCAAGCCGACTCTCACCATCATCAAGACGGAAAAAGTCGATCTGGAG
                                                                                

HsCD00001052        ------------------CTTTTCCCCTCCCCGGATATGGAATGTGCAGATGTCCCACTA
NM_001143820.1      GAAGTTCCTACTGGTCTTGAACACTGTGTCTCAGATATGGAATGTGCAGATGTCCCACTA
XM_005271428.1      ---------------------ATGTGTGAGCCTGATATGGAATGTGCAGATGTCCCACTA
NM_005238.3         ------------------CTTTTCCCCTCCCCGGATATGGAATGTGCAGATGTCCCACTA
                                          :        * ***************************

HsCD00001052        TTAACTCCAAGCAGCAAAGAAATGATGTCTCAAGCATTAAAAGCTACTTTCAGTGGTTTC
NM_001143820.1      TTAACTCCAAGCAGCAAAGAAATGATGTCTCAAGCATTAAAAGCTACTTTCAGTGGTTTC
XM_005271428.1      TTAACTCCAAGCAGCAAAGAAATGATGTCTCAAGCATTAAAAGCTACTTTCAGTGGTTTC
NM_005238.3         TTAACTCCAAGCAGCAAAGAAATGATGTCTCAAGCATTAAAAGCTACTTTCAGTGGTTTC
                    ************************************************************

HsCD00001052        ACTAAAGAACAGCAACGACTGGGGATCCCAAAAGACCCCCGGCAGTGGACAGAAACCCAT
NM_001143820.1      ACTAAAGAACAGCAACGACTGGGGATCCCAAAAGACCCCCGGCAGTGGACAGAAACCCAT
XM_005271428.1      ACTAAAGAACAGCAACGACTGGGGATCCCAAAAGACCCCCGGCAGTGGACAGAAACCCAT
NM_005238.3         ACTAAAGAACAGCAACGACTGGGGATCCCAAAAGACCCCCGGCAGTGGACAGAAACCCAT
                    ************************************************************

HsCD00001052        GTTCGGGACTGGGTGATGTGGGCTGTGAATGAATTCAGCCTGAAAGGTGTAGACTTCCAG
NM_001143820.1      GTTCGGGACTGGGTGATGTGGGCTGTGAATGAATTCAGCCTGAAAGGTGTAGACTTCCAG
XM_005271428.1      GTTCGGGACTGGGTGATGTGGGCTGTGAATGAATTCAGCCTGAAAGGTGTAGACTTCCAG
NM_005238.3         GTTCGGGACTGGGTGATGTGGGCTGTGAATGAATTCAGCCTGAAAGGTGTAGACTTCCAG
                    ************************************************************

HsCD00001052        AAGTTCTGTATGAATGGAGCAGCCCTCTGCGCCCTGGGTAAAGACTGCTTTCTCGAGCTG
NM_001143820.1      AAGTTCTGTATGAATGGAGCAGCCCTCTGCGCCCTGGGTAAAGACTGCTTTCTCGAGCTG
XM_005271428.1      AAGTTCTGTATGAATGGAGCAGCCCTCTGCGCCCTGGGTAAAGACTGCTTTCTCGAGCTG
NM_005238.3         AAGTTCTGTATGAATGGAGCAGCCCTCTGCGCCCTGGGTAAAGACTGCTTTCTCGAGCTG
                    ************************************************************

HsCD00001052        GCCCCAGACTTTGTTGGGGACATCTTATGGGAACATCTAGAGATCCTGCAGAAAGAGGAT
NM_001143820.1      GCCCCAGACTTTGTTGGGGACATCTTATGGGAACATCTAGAGATCCTGCAGAAAGAGGAT
XM_005271428.1      GCCCCAGACTTTGTTGGGGACATCTTATGGGAACATCTAGAGATCCTGCAGAAAGAGGAT
NM_005238.3         GCCCCAGACTTTGTTGGGGACATCTTATGGGAACATCTAGAGATCCTGCAGAAAGAGGAT
                    ************************************************************

HsCD00001052        GTGAAACCATATCAAGTTAATGGAGTCAACCCAGCCTATCCAGAATCCCGCTATACCTCG
NM_001143820.1      GTGAAACCATATCAAGTTAATGGAGTCAACCCAGCCTATCCAGAATCCCGCTATACCTCG
XM_005271428.1      GTGAAACCATATCAAGTTAATGGAGTCAACCCAGCCTATCCAGAATCCCGCTATACCTCG
NM_005238.3         GTGAAACCATATCAAGTTAATGGAGTCAACCCAGCCTATCCAGAATCCCGCTATACCTCG
                    ************************************************************

HsCD00001052        GATTACTTCATTAGCTATGGTATTGAGCATGCCCAGTGTGTTCCACCATCGGAGTTCTCA
NM_001143820.1      GATTACTTCATTAGCTATGGTATTGAGCATGCCCAGTGTGTTCCACCATCGGAGTTCTCA
XM_005271428.1      GATTACTTCATTAGCTATGGTATTGAGCATGCCCAGTGTGTTCCACCATCGGAGTTCTCA
NM_005238.3         GATTACTTCATTAGCTATGGTATTGAGCATGCCCAGTGTGTTCCACCATCGGAGTTCTCA
                    ************************************************************

HsCD00001052        GAGCCCAGCTTCATCACAGAGTCCTATCAGACGCTCCATCCCATCAGCTCGGAAGAGCTC
NM_001143820.1      GAGCCCAGCTTCATCACAGAGTCCTATCAGACGCTCCATCCCATCAGCTCGGAAGAGCTC
XM_005271428.1      GAGCCCAGCTTCATCACAGAGTCCTATCAGACGCTCCATCCCATCAGCTCGGAAGAGCTC
NM_005238.3         GAGCCCAGCTTCATCACAGAGTCCTATCAGACGCTCCATCCCATCAGCTCGGAAGAGCTC
                    ************************************************************

HsCD00001052        CTCTCCCTCAAGTATGAGAATGACTACCCCTCGGTCATTCTCCGAGACCCTCTCCAGACA
NM_001143820.1      CTCTCCCTCAAGTATGAGAATGACTACCCCTCGGTCATTCTCCGAGACCCTCTCCAGACA
XM_005271428.1      CTCTCCCTCAAGTATGAGAATGACTACCCCTCGGTCATTCTCCGAGACCCTCTCCAGACA
NM_005238.3         CTCTCCCTCAAGTATGAGAATGACTACCCCTCGGTCATTCTCCGAGACCCTCTCCAGACA
                    ************************************************************

HsCD00001052        GACACCTTGCAGAATGACTACTTTGCTATCAAACAAGAAGTCTTCACCCCAGACAACATG
NM_001143820.1      GACACCTTGCAGAATGACTACTTTGCTATCAAACAAGAAGTCGTCACCCCAGACAACATG
XM_005271428.1      GACACCTTGCAGAATGACTACTTTGCTATCAAACAAGAAGTCGTCACCCCAGACAACATG
NM_005238.3         GACACCTTGCAGAATGACTACTTTGCTATCAAACAAGAAGTCGTCACCCCAGACAACATG
                    ****************************************** *****************

HsCD00001052        TGCATGGGGAGGACCAGTCGTGGTAAACTCGGGGGCCAGGACTCTTTTGAAAGCATAGAG
NM_001143820.1      TGCATGGGGAGGACCAGTCGTGGTAAACTCGGGGGCCAGGACTCTTTTGAAAGCATAGAG
XM_005271428.1      TGCATGGGGAGGACCAGTCGTGGTAAACTCGGGGGCCAGGACTCTTTTGAAAGCATAGAG
NM_005238.3         TGCATGGGGAGGACCAGTCGTGGTAAACTCGGGGGCCAGGACTCTTTTGAAAGCATAGAG
                    ************************************************************

HsCD00001052        AGCTACGATAGTTGTGATCGCCTCACCCAGTCCTGGAGCAGCCAGTCATCTTTCAACAGC
NM_001143820.1      AGCTACGATAGTTGTGATCGCCTCACCCAGTCCTGGAGCAGCCAGTCATCTTTCAACAGC
XM_005271428.1      AGCTACGATAGTTGTGATCGCCTCACCCAGTCCTGGAGCAGCCAGTCATCTTTCAACAGC
NM_005238.3         AGCTACGATAGTTGTGATCGCCTCACCCAGTCCTGGAGCAGCCAGTCATCTTTCAACAGC
                    ************************************************************

HsCD00001052        CTGCAGCGTGTTCCCTCCTATGACAGCTTCGACTCAGAGGACTATCCGGCTGCCCTGCCC
NM_001143820.1      CTGCAGCGTGTTCCCTCCTATGACAGCTTCGACTCAGAGGACTATCCGGCTGCCCTGCCC
XM_005271428.1      CTGCAGCGTGTTCCCTCCTATGACAGCTTCGACTCAGAGGACTATCCGGCTGCCCTGCCC
NM_005238.3         CTGCAGCGTGTTCCCTCCTATGACAGCTTCGACTCAGAGGACTATCCGGCTGCCCTGCCC
                    ************************************************************

HsCD00001052        AACCACAAGCCCAAGGGCACCTTCAAGGACTATGTGCGGGACCGTGCTGACCTCAATAAG
NM_001143820.1      AACCACAAGCCCAAGGGCACCTTCAAGGACTATGTGCGGGACCGTGCTGACCTCAATAAG
XM_005271428.1      AACCACAAGCCCAAGGGCACCTTCAAGGACTATGTGCGGGACCGTGCTGACCTCAATAAG
NM_005238.3         AACCACAAGCCCAAGGGCACCTTCAAGGACTATGTGCGGGACCGTGCTGACCTCAATAAG
                    ************************************************************

HsCD00001052        GACAAGCCTGTCATTCCTGCTGCTGCCCTAGCTGGCTACACAGGCAGTGGACCAATCCAG
NM_001143820.1      GACAAGCCTGTCATTCCTGCTGCTGCCCTAGCTGGCTACACAGGCAGTGGACCAATCCAG
XM_005271428.1      GACAAGCCTGTCATTCCTGCTGCTGCCCTAGCTGGCTACACAGGCAGTGGACCAATCCAG
NM_005238.3         GACAAGCCTGTCATTCCTGCTGCTGCCCTAGCTGGCTACACAGGCAGTGGACCAATCCAG
                    ************************************************************

HsCD00001052        CTATGGCAGTTTCTTCTGGAATTACTCACTGATAAATCCTGTCAGTCTTTTATCAGCTGG
NM_001143820.1      CTATGGCAGTTTCTTCTGGAATTACTCACTGATAAATCCTGTCAGTCTTTTATCAGCTGG
XM_005271428.1      CTATGGCAGTTTCTTCTGGAATTACTCACTGATAAATCCTGTCAGTCTTTTATCAGCTGG
NM_005238.3         CTATGGCAGTTTCTTCTGGAATTACTCACTGATAAATCCTGTCAGTCTTTTATCAGCTGG
                    ************************************************************

HsCD00001052        ACAGGAGATGGCTGGGAATTCAAACTTTCTGACCCAGATGAGGTGGCCAGGAGATGGGGA
NM_001143820.1      ACAGGAGATGGCTGGGAATTCAAACTTTCTGACCCAGATGAGGTGGCCAGGAGATGGGGA
XM_005271428.1      ACAGGAGATGGCTGGGAATTCAAACTTTCTGACCCAGATGAGGTGGCCAGGAGATGGGGA
NM_005238.3         ACAGGAGATGGCTGGGAATTCAAACTTTCTGACCCAGATGAGGTGGCCAGGAGATGGGGA
                    ************************************************************

HsCD00001052        AAGAGGAAAAACAAACCTAAGATGAATTATGAGAAACTGAGCCGTGGCCTACGCTACTAT
NM_001143820.1      AAGAGGAAAAACAAACCTAAGATGAATTATGAGAAACTGAGCCGTGGCCTACGCTACTAT
XM_005271428.1      AAGAGGAAAAACAAACCTAAGATGAATTATGAGAAACTGAGCCGTGGCCTACGCTACTAT
NM_005238.3         AAGAGGAAAAACAAACCTAAGATGAATTATGAGAAACTGAGCCGTGGCCTACGCTACTAT
                    ************************************************************

HsCD00001052        TACGACAAAAACATCATCCACAAGACAGCGGGGAAACGCTACGTGTACCGCTTTGTGTGT
NM_001143820.1      TACGACAAAAACATCATCCACAAGACAGCGGGGAAACGCTACGTGTACCGCTTTGTGTGT
XM_005271428.1      TACGACAAAAACATCATCCACAAGACAGCGGGGAAACGCTACGTGTACCGCTTTGTGTGT
NM_005238.3         TACGACAAAAACATCATCCACAAGACAGCGGGGAAACGCTACGTGTACCGCTTTGTGTGT
                    ************************************************************

HsCD00001052        GACCTGCAGAGCCTGCTGGGGTACACCCCTGAGGAGCTGCACGCCATGCTGGACGTCAAG
NM_001143820.1      GACCTGCAGAGCCTGCTGGGGTACACCCCTGAGGAGCTGCACGCCATGCTGGACGTCAAG
XM_005271428.1      GACCTGCAGAGCCTGCTGGGGTACACCCCTGAGGAGCTGCACGCCATGCTGGACGTCAAG
NM_005238.3         GACCTGCAGAGCCTGCTGGGGTACACCCCTGAGGAGCTGCACGCCATGCTGGACGTCAAG
                    ************************************************************

HsCD00001052        CCAGATGCCGACGAGTAG
NM_001143820.1      CCAGATGCCGACGAGTGA
XM_005271428.1      CCAGATGCCGACGAGTGA
NM_005238.3         CCAGATGCCGACGAGTGA
                    ****************..

Pathways

NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : AP-1 transcription factor network
NCI : BCR signaling pathway
NCI : C-MYB transcription factor network
NCI : HIF-1-alpha transcription factor network
NCI : HIF-2-alpha transcription factor network
NCI : IL4-mediated signaling events
NCI : Signaling events mediated by focal adhesion kinase
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
Panther : Angiogenesis
Panther : PDGF signaling pathway
Panther : Ras Pathway
Panther : VEGF signaling pathway
Reactome : Cellular responses to stress
Reactome : Cellular Senescence
Reactome : Oncogene Induced Senescence
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : Neural Crest Differentiation
WikiPathway : TGF beta Signaling Pathway

Protein

SMART domain : ETS : erythroblast transformation specific domain
SMART domain : SAM_PNT : SAM / Pointed domain
UniProt : B4DW78
UniProt : P14921
UniProt : Q6N087
UniProt : A8K725
HPRD : 01260

Clone

Cloning Information : 8825
HIP Master Clone ID : 11320
Original Clone ID : FLH008825.01X

Organism


TAX_ID : 9606
Species Specific ID: 2113

Genome

Chromosome : 11
Map Location : 11q23.3
Ensembl : ENSG00000134954

Reagents

Labome : Ets1-antibody