DNASU Plasmid Repository • 480.965.5697 | Email

PTN (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PTN
Gene Name:  pleiotrophin
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH008698.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00001062

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 507nts         Open reading frame : 1 to 507

ATGCAGGCTCAACAGTACCAGCAGCAGCGTCGAAAATTTGCAGCTGCCTTCTTGGCATTC
ATTTTCATACTGGCAGCTGTGGATACTGCTGAAGCAGGGAAGAAAGAGAAACCAGAAAAA
AAAGTGAAGAAGTCTGACTGTGGAGAATGGCAGTGGAGTGTGTGTGTGCCCACCAGTGGA
GACTGTGGGCTGGGCACACGGGAGGGCACTCGGACTGGAGCTGGGTGCAAGCAAACCATG
AAGACCCAGAGATGTAAGATCCCCTGCAACTGGAAGAAGCAATTTGGCGCGGAGTGCAAA
TACCAGTTCCAGGCCTGGGGAGAATGTGACCTGAACACAGCCCTGAAGACCAGAACTGGA
AGTCTGAAGCGAGCCCTGCACAATGCCGAATGCCAGAAGACTGTCACCATCTCCAAGCCC
TGTGGCAAACTGACCAAGCCCAAACCTCAAGCAGAATCTAAGAAGAAGAAAAAGGAAGGC
AAGAAACAGGAGAAGATGCTGGATTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2048
Start on reference sequence 1542
Mutations:
None
Discrepancy:
a224g,E75G
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PTN
Symbol Nomenclature : PTN
SYNONYM : HARP; HBGF8; HBNF; NEGF1
Designation : HB-GAM|HBBM|HBGF-8|HBNF-1|OSF-1|heparin affin regulatory protein|heparin binding growth factor 8|heparin-binding brain mitogen|heparin-binding growth factor 8|heparin-binding growth-associated molecule|heparin-binding neurite outgrowth-promoting factor 1|neurite growth-promoting factor 1|osteoblast-specific factor 1|pleiotrophin (heparin binding growth factor 8, neurite growth-promoting factor 1)
Full Nomenclature : pleiotrophin
GENEID : 5764
GI : 61357920
GenBank Accession : AY888528
HGNC : 9630
MIM : 162095
Vega : OTTHUMG00000155709
Target GenBank: NM_002825

 

Pathways

NCI : Syndecan-3-mediated signaling events

Protein

SMART domain : PTN : Pleiotrophin / midkine family
UniProt : P21246
HPRD : 01199

Clone

Cloning Information : 8698
HIP Master Clone ID : 11193
Original Clone ID : FLH008698.01X

Organism


TAX_ID : 9606
Species Specific ID: 5764

Genome

Chromosome : 7
Map Location : 7q33
Ensembl : ENSG00000105894

Reagents

Labome : PTN-antibody