DNASU Plasmid Repository • 480.965.5697 | Email

TGFBR2 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TGFBR2
Gene Name:  transforming growth factor, beta receptor II (70/80kDa)
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH000217.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00000108

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1704nts         Open reading frame : 1 to 1704
Reference Sequence Alignment

ATGGGTCGGGGGCTGCTCAGGGGCCTGTGGCCGCTGCACATCGTCCTGTGGACGCGTATC
GCCAGCACGATCCCACCGCACGTTCAGAAGTCGGTTAATAACGACATGATAGTCACTGAC
AACAACGGTGCAGTCAAGTTTCCACAACTGTGTAAATTTTGTGATGTGAGATTTTCCACC
TGTGACAACCAGAAATCCTGCATGAGCAACTGCAGCATCACCTCCATCTGTGAGAAGCCA
CAGGAAGTCTGTGTGGCTGTATGGAGAAAGAATGACGAGAACATAACACTAGAGACAGTT
TGCCATGACCCCAAGCTCCCCTACCATGACTTTATTCTGGAAGATGCTGCTTCTCCAAAG
TGCATTATGAAGGAAAAAAAAAAGCCTGGTGAGACTTTCTTCATGTGTTCCTGTAGCTCT
GATGAGTGCAATGACAACATCATCTTCTCAGAAGAATATAACACCAGCAATCCTGACTTG
TTGCTAGTCATATTTCAAGTGACAGGCATCAGCCTCCTGCCACCACTGGGAGTTGCCATA
TCTGTCATCATCATCTTCTACTGCTACCGCGTTAACCGGCAGCAGAAGCTGAGTTCAACC
TGGGAAACCGGCAAGACGCGGAAGCTCATGGAGTTCAGCGAGCACTGTGCCATCATCCTG
GAAGATGACCGCTCTGACATCAGCTCCACGTGTGCCAACAACATCAACCACAACACAGAG
CTGCTGCCCATTGAGCTGGACACCCTGGTGGGGAAAGGTCGCTTTGCTGAGGTCTATAAG
GCCAAGCTGAAGCAGAACACTTCAGAGCAGTTTGAGACAGTGGCAGTCAAGATCTTTCCC
TATGAGGAGTATGCCTCTTGGAAGACAGAGAAGGACATCTTCTCAGACATCAATCTGAAG
CATGAGAACATACTCCAGTTCCTGACGGCTGAGGAGCGGAAGACGGAGTTGGGGAAACAA
TACTGGCTGATCACCGCCTTCCACGCCAAGGGCAACCTACAGGAGTACCTGACGCGGCAT
GTCATCAGCTGGGAGGACCTGCGCAAGCTGGGCAGCTCCCTCGCCCGGGGGATTGCTCAC
CTCCACAGTGATCACACTCCATGTGGGAGGCCCAAGATGCCCATCGTGCACAGGGACCTC
AAGAGCTCCAATATCCTCGTGAAGAACGACCTAACCTGCTGCCTGTGTGACTTTGGGCTT
TCCCTGCGTCTGGACCCTACTCTGTCTGTGGATGACCTGGCTAACAGTGGGCAGGTGGGA
ACTGCAAGATACATGGCTCCAGAAGTCCTAGAATCCAGGATGAATTTGGAGAATGTTGAG
TCCTTCAAGCAGACCGATGTCTACTCCATGGCTCTGGTGCTCTGGGAAATGACATCTCGC
TGTAATGCAGTGGGAGAAGTAAAAGATTATGAGCCTCCATTTGGTTCCAAGGTGCGGGAG
CACCCCTGTGTCGAAAGCATGAAGGACAACGTGTTGAGAGATCGAGGGCGACCAGAAATT
CCCAGCTTCTGGCTCAACCACCAGGGCATCCAGATGGTGTGTGAGACGTTGACTGAGTGC
TGGGACCACGACCCAGAGGCCCGTCTCACAGCCCAGTGTGTGGCAGAACGCTTCAGTGAG
CTGGAGCATCTGGACAGGCTCTCGGGGAGGAGCTGCTCGGAGGAGAAGATTCCTGAAGAC
GGCTCCCTAAACACTACCAAATTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2039
Start on reference sequence 336
Mutations:
None
Discrepancy:
c1316t,A439V
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TGFBR2
Symbol Nomenclature : TGFBR2
SYNONYM : AAT3; FAA3; LDS1B; LDS2B; MFS2; RIIC; TAAD2; TGFR-2; TGFbeta-RII
Designation : TGF-beta receptor type IIB|TGF-beta receptor type-2|TGF-beta type II receptor|tbetaR-II|transforming growth factor beta receptor type IIC
Full Nomenclature : transforming growth factor, beta receptor II (70/80kDa)
GENEID : 7048
GI : 33304176
GenBank Accession : AY335769
HGNC : 11773
MIM : 190182
Vega : OTTHUMG00000130569
Target GenBank: NM_003242

 

Reference Sequence Alignment

  

HsCD00000108        ATGGGTCGGGGGCTGCTCAGGGGCCTGTGGCCGCTGCACATCGTCCTGTGGACGCGTATC
NM_001024847.2      ATGGGTCGGGGGCTGCTCAGGGGCCTGTGGCCGCTGCACATCGTCCTGTGGACGCGTATC
NM_003242.5         ATGGGTCGGGGGCTGCTCAGGGGCCTGTGGCCGCTGCACATCGTCCTGTGGACGCGTATC
                    ************************************************************

HsCD00000108        GCCAGCACGATCCCACCGCACGTTCAGAAGTCG---------------------------
NM_001024847.2      GCCAGCACGATCCCACCGCACGTTCAGAAG---TCGGATGTGGAAATGGAGGCCCAGAAA
NM_003242.5         GCCAGCACGATCCCACCGCACGTTCAGAAG---TCG------------------------
                    ******************************                              

HsCD00000108        ---------------------------------------------------GTTAATAAC
NM_001024847.2      GATGAAATCATCTGCCCCAGCTGTAATAGGACTGCCCATCCACTGAGACATATTAATAAC
NM_003242.5         ---------------------------------------------------GTTAATAAC
                                                                       .********

HsCD00000108        GACATGATAGTCACTGACAACAACGGTGCAGTCAAGTTTCCACAACTGTGTAAATTTTGT
NM_001024847.2      GACATGATAGTCACTGACAACAACGGTGCAGTCAAGTTTCCACAACTGTGTAAATTTTGT
NM_003242.5         GACATGATAGTCACTGACAACAACGGTGCAGTCAAGTTTCCACAACTGTGTAAATTTTGT
                    ************************************************************

HsCD00000108        GATGTGAGATTTTCCACCTGTGACAACCAGAAATCCTGCATGAGCAACTGCAGCATCACC
NM_001024847.2      GATGTGAGATTTTCCACCTGTGACAACCAGAAATCCTGCATGAGCAACTGCAGCATCACC
NM_003242.5         GATGTGAGATTTTCCACCTGTGACAACCAGAAATCCTGCATGAGCAACTGCAGCATCACC
                    ************************************************************

HsCD00000108        TCCATCTGTGAGAAGCCACAGGAAGTCTGTGTGGCTGTATGGAGAAAGAATGACGAGAAC
NM_001024847.2      TCCATCTGTGAGAAGCCACAGGAAGTCTGTGTGGCTGTATGGAGAAAGAATGACGAGAAC
NM_003242.5         TCCATCTGTGAGAAGCCACAGGAAGTCTGTGTGGCTGTATGGAGAAAGAATGACGAGAAC
                    ************************************************************

HsCD00000108        ATAACACTAGAGACAGTTTGCCATGACCCCAAGCTCCCCTACCATGACTTTATTCTGGAA
NM_001024847.2      ATAACACTAGAGACAGTTTGCCATGACCCCAAGCTCCCCTACCATGACTTTATTCTGGAA
NM_003242.5         ATAACACTAGAGACAGTTTGCCATGACCCCAAGCTCCCCTACCATGACTTTATTCTGGAA
                    ************************************************************

HsCD00000108        GATGCTGCTTCTCCAAAGTGCATTATGAAGGAAAAAAAAAAGCCTGGTGAGACTTTCTTC
NM_001024847.2      GATGCTGCTTCTCCAAAGTGCATTATGAAGGAAAAAAAAAAGCCTGGTGAGACTTTCTTC
NM_003242.5         GATGCTGCTTCTCCAAAGTGCATTATGAAGGAAAAAAAAAAGCCTGGTGAGACTTTCTTC
                    ************************************************************

HsCD00000108        ATGTGTTCCTGTAGCTCTGATGAGTGCAATGACAACATCATCTTCTCAGAAGAATATAAC
NM_001024847.2      ATGTGTTCCTGTAGCTCTGATGAGTGCAATGACAACATCATCTTCTCAGAAGAATATAAC
NM_003242.5         ATGTGTTCCTGTAGCTCTGATGAGTGCAATGACAACATCATCTTCTCAGAAGAATATAAC
                    ************************************************************

HsCD00000108        ACCAGCAATCCTGACTTGTTGCTAGTCATATTTCAAGTGACAGGCATCAGCCTCCTGCCA
NM_001024847.2      ACCAGCAATCCTGACTTGTTGCTAGTCATATTTCAAGTGACAGGCATCAGCCTCCTGCCA
NM_003242.5         ACCAGCAATCCTGACTTGTTGCTAGTCATATTTCAAGTGACAGGCATCAGCCTCCTGCCA
                    ************************************************************

HsCD00000108        CCACTGGGAGTTGCCATATCTGTCATCATCATCTTCTACTGCTACCGCGTTAACCGGCAG
NM_001024847.2      CCACTGGGAGTTGCCATATCTGTCATCATCATCTTCTACTGCTACCGCGTTAACCGGCAG
NM_003242.5         CCACTGGGAGTTGCCATATCTGTCATCATCATCTTCTACTGCTACCGCGTTAACCGGCAG
                    ************************************************************

HsCD00000108        CAGAAGCTGAGTTCAACCTGGGAAACCGGCAAGACGCGGAAGCTCATGGAGTTCAGCGAG
NM_001024847.2      CAGAAGCTGAGTTCAACCTGGGAAACCGGCAAGACGCGGAAGCTCATGGAGTTCAGCGAG
NM_003242.5         CAGAAGCTGAGTTCAACCTGGGAAACCGGCAAGACGCGGAAGCTCATGGAGTTCAGCGAG
                    ************************************************************

HsCD00000108        CACTGTGCCATCATCCTGGAAGATGACCGCTCTGACATCAGCTCCACGTGTGCCAACAAC
NM_001024847.2      CACTGTGCCATCATCCTGGAAGATGACCGCTCTGACATCAGCTCCACGTGTGCCAACAAC
NM_003242.5         CACTGTGCCATCATCCTGGAAGATGACCGCTCTGACATCAGCTCCACGTGTGCCAACAAC
                    ************************************************************

HsCD00000108        ATCAACCACAACACAGAGCTGCTGCCCATTGAGCTGGACACCCTGGTGGGGAAAGGTCGC
NM_001024847.2      ATCAACCACAACACAGAGCTGCTGCCCATTGAGCTGGACACCCTGGTGGGGAAAGGTCGC
NM_003242.5         ATCAACCACAACACAGAGCTGCTGCCCATTGAGCTGGACACCCTGGTGGGGAAAGGTCGC
                    ************************************************************

HsCD00000108        TTTGCTGAGGTCTATAAGGCCAAGCTGAAGCAGAACACTTCAGAGCAGTTTGAGACAGTG
NM_001024847.2      TTTGCTGAGGTCTATAAGGCCAAGCTGAAGCAGAACACTTCAGAGCAGTTTGAGACAGTG
NM_003242.5         TTTGCTGAGGTCTATAAGGCCAAGCTGAAGCAGAACACTTCAGAGCAGTTTGAGACAGTG
                    ************************************************************

HsCD00000108        GCAGTCAAGATCTTTCCCTATGAGGAGTATGCCTCTTGGAAGACAGAGAAGGACATCTTC
NM_001024847.2      GCAGTCAAGATCTTTCCCTATGAGGAGTATGCCTCTTGGAAGACAGAGAAGGACATCTTC
NM_003242.5         GCAGTCAAGATCTTTCCCTATGAGGAGTATGCCTCTTGGAAGACAGAGAAGGACATCTTC
                    ************************************************************

HsCD00000108        TCAGACATCAATCTGAAGCATGAGAACATACTCCAGTTCCTGACGGCTGAGGAGCGGAAG
NM_001024847.2      TCAGACATCAATCTGAAGCATGAGAACATACTCCAGTTCCTGACGGCTGAGGAGCGGAAG
NM_003242.5         TCAGACATCAATCTGAAGCATGAGAACATACTCCAGTTCCTGACGGCTGAGGAGCGGAAG
                    ************************************************************

HsCD00000108        ACGGAGTTGGGGAAACAATACTGGCTGATCACCGCCTTCCACGCCAAGGGCAACCTACAG
NM_001024847.2      ACGGAGTTGGGGAAACAATACTGGCTGATCACCGCCTTCCACGCCAAGGGCAACCTACAG
NM_003242.5         ACGGAGTTGGGGAAACAATACTGGCTGATCACCGCCTTCCACGCCAAGGGCAACCTACAG
                    ************************************************************

HsCD00000108        GAGTACCTGACGCGGCATGTCATCAGCTGGGAGGACCTGCGCAAGCTGGGCAGCTCCCTC
NM_001024847.2      GAGTACCTGACGCGGCATGTCATCAGCTGGGAGGACCTGCGCAAGCTGGGCAGCTCCCTC
NM_003242.5         GAGTACCTGACGCGGCATGTCATCAGCTGGGAGGACCTGCGCAAGCTGGGCAGCTCCCTC
                    ************************************************************

HsCD00000108        GCCCGGGGGATTGCTCACCTCCACAGTGATCACACTCCATGTGGGAGGCCCAAGATGCCC
NM_001024847.2      GCCCGGGGGATTGCTCACCTCCACAGTGATCACACTCCATGTGGGAGGCCCAAGATGCCC
NM_003242.5         GCCCGGGGGATTGCTCACCTCCACAGTGATCACACTCCATGTGGGAGGCCCAAGATGCCC
                    ************************************************************

HsCD00000108        ATCGTGCACAGGGACCTCAAGAGCTCCAATATCCTCGTGAAGAACGACCTAACCTGCTGC
NM_001024847.2      ATCGTGCACAGGGACCTCAAGAGCTCCAATATCCTCGTGAAGAACGACCTAACCTGCTGC
NM_003242.5         ATCGTGCACAGGGACCTCAAGAGCTCCAATATCCTCGTGAAGAACGACCTAACCTGCTGC
                    ************************************************************

HsCD00000108        CTGTGTGACTTTGGGCTTTCCCTGCGTCTGGACCCTACTCTGTCTGTGGATGACCTGGCT
NM_001024847.2      CTGTGTGACTTTGGGCTTTCCCTGCGTCTGGACCCTACTCTGTCTGTGGATGACCTGGCT
NM_003242.5         CTGTGTGACTTTGGGCTTTCCCTGCGTCTGGACCCTACTCTGTCTGTGGATGACCTGGCT
                    ************************************************************

HsCD00000108        AACAGTGGGCAGGTGGGAACTGCAAGATACATGGCTCCAGAAGTCCTAGAATCCAGGATG
NM_001024847.2      AACAGTGGGCAGGTGGGAACTGCAAGATACATGGCTCCAGAAGTCCTAGAATCCAGGATG
NM_003242.5         AACAGTGGGCAGGTGGGAACTGCAAGATACATGGCTCCAGAAGTCCTAGAATCCAGGATG
                    ************************************************************

HsCD00000108        AATTTGGAGAATGTTGAGTCCTTCAAGCAGACCGATGTCTACTCCATGGCTCTGGTGCTC
NM_001024847.2      AATTTGGAGAATGTTGAGTCCTTCAAGCAGACCGATGTCTACTCCATGGCTCTGGTGCTC
NM_003242.5         AATTTGGAGAATGTTGAGTCCTTCAAGCAGACCGATGTCTACTCCATGGCTCTGGTGCTC
                    ************************************************************

HsCD00000108        TGGGAAATGACATCTCGCTGTAATGCAGTGGGAGAAGTAAAAGATTATGAGCCTCCATTT
NM_001024847.2      TGGGAAATGACATCTCGCTGTAATGCAGTGGGAGAAGTAAAAGATTATGAGCCTCCATTT
NM_003242.5         TGGGAAATGACATCTCGCTGTAATGCAGTGGGAGAAGTAAAAGATTATGAGCCTCCATTT
                    ************************************************************

HsCD00000108        GGTTCCAAGGTGCGGGAGCACCCCTGTGTCGAAAGCATGAAGGACAACGTGTTGAGAGAT
NM_001024847.2      GGTTCCAAGGTGCGGGAGCACCCCTGTGTCGAAAGCATGAAGGACAACGTGTTGAGAGAT
NM_003242.5         GGTTCCAAGGTGCGGGAGCACCCCTGTGTCGAAAGCATGAAGGACAACGTGTTGAGAGAT
                    ************************************************************

HsCD00000108        CGAGGGCGACCAGAAATTCCCAGCTTCTGGCTCAACCACCAGGGCATCCAGATGGTGTGT
NM_001024847.2      CGAGGGCGACCAGAAATTCCCAGCTTCTGGCTCAACCACCAGGGCATCCAGATGGTGTGT
NM_003242.5         CGAGGGCGACCAGAAATTCCCAGCTTCTGGCTCAACCACCAGGGCATCCAGATGGTGTGT
                    ************************************************************

HsCD00000108        GAGACGTTGACTGAGTGCTGGGACCACGACCCAGAGGCCCGTCTCACAGCCCAGTGTGTG
NM_001024847.2      GAGACGTTGACTGAGTGCTGGGACCACGACCCAGAGGCCCGTCTCACAGCCCAGTGTGTG
NM_003242.5         GAGACGTTGACTGAGTGCTGGGACCACGACCCAGAGGCCCGTCTCACAGCCCAGTGTGTG
                    ************************************************************

HsCD00000108        GCAGAACGCTTCAGTGAGCTGGAGCATCTGGACAGGCTCTCGGGGAGGAGCTGCTCGGAG
NM_001024847.2      GCAGAACGCTTCAGTGAGCTGGAGCATCTGGACAGGCTCTCGGGGAGGAGCTGCTCGGAG
NM_003242.5         GCAGAACGCTTCAGTGAGCTGGAGCATCTGGACAGGCTCTCGGGGAGGAGCTGCTCGGAG
                    ************************************************************

HsCD00000108        GAGAAGATTCCTGAAGACGGCTCCCTAAACACTACCAAATTG
NM_001024847.2      GAGAAGATTCCTGAAGACGGCTCCCTAAACACTACCAAATAG
NM_003242.5         GAGAAGATTCCTGAAGACGGCTCCCTAAACACTACCAAATAG
                    ****************************************:*

Pathways

NCI : ALK1 signaling events
NCI : Beta3 integrin cell surface interactions
NCI : Glypican 1 network
NCI : Integrins in angiogenesis
NCI : TGF-beta receptor signaling
Panther : TGF-beta signaling pathway
Reactome : Disease
Reactome : Downregulation of TGF-beta receptor signaling
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : Signal Transduction
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : TGF-beta receptor signaling activates SMADs
Reactome : TGF-beta receptor signaling in EMT (epithelial to mesenchymal transition)
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer
WikiPathway : Adipocyte TarBase
WikiPathway : Epithelium TarBase
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Lymphocyte TarBase
WikiPathway : MAPK signaling pathway
WikiPathway : Muscle cell TarBase
WikiPathway : Squamous cell TarBase
WikiPathway : TGF Beta Signaling Pathway
WikiPathway : TGF beta Signaling Pathway

Clone

Cloning Information : 217
HIP Master Clone ID : 87244
Original Clone ID : FLH000217.01L

Organism


TAX_ID : 9606
Species Specific ID: 7048

Genome

Chromosome : 3
Map Location : 3p22
Ensembl : ENSG00000163513

Reagents

Labome : TGFBR2-antibody