DNASU Plasmid Repository • 480.965.5697 | Email

ERBB4 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ERBB4
Gene Name:  v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH167267.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00000109

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3927nts         Open reading frame : 1 to 3927
Reference Sequence Alignment

ATGAAGCCGGCGACAGGACTTTGGGTCTGGGTGAGCCTTCTCGTGGCGGCGGGGACCGTC
CAGCCCAGCGATTCTCAGTCAGTGTGTGCAGGAACGGAGAATAAACTGAGCTCTCTCTCT
GACCTGGAACAGCAGTACCGAGCCTTGCGCAAGTACTATGAAAACTGTGAGGTTGTCATG
GGCAACCTGGAGATAACCAGCATTGAGCACAACCGGGACCTCTCCTTCCTGCGGTCTGTT
CGAGAAGTCACAGGCTACGTGTTAGTGGCTCTTAATCAGTTTCGTTACCTGCCTCTGGAG
AATTTACGCATTATTCGTGGGACAAAACTTTATGAGGATCGATATGCCTTGGCAATATTT
TTAAACTACAGAAAAGATGGAAACTTTGGACTTCAAGAACTTGGATTAAAGAACTTGACA
GAAATCCTAAATGGTGGAGTCTATGTAGACCAGAACAAATTCCTTTGTTATGCAGACACC
ATTCATTGGCAAGATATTGTTCGGAACCCATGGCCTTCCAACTTGACTCTTGTGTCAACA
AATGGTAGTTCAGGATGTGGACGTTGCCATAAGTCCTGTACTGGCCGTTGCTGGGGACCC
ACAGAAAATCATTGCCAGACTTTGACAAGGACGGTGTGTGCAGAACAATGTGACGGCAGA
TGCTACGGACCTTACGTCAGTGACTGCTGCCATCGAGAATGTGCTGGAGGCTGCTCAGGA
CCTAAGGACACAGACTGCTTTGCCTGCATGAATTTCAATGACAGTGGAGCATGTGTTACT
CAGTGTCCCCAAACCTTTGTCTACAATCCAACCACCTTTCAACTGGAGCACAATTTCAAT
GCAAAGTACACATATGGAGCATTCTGTGTCAAGAAATGTCCACATAACTTTGTGGTAGAT
TCCAGTTCTTGTGTGCGTGCCTGCCCTAGTTCCAAGATGGAAGTAGAAGAAAATGGGATT
AAAATGTGTAAACCTTGCACTGACATTTGCCCAAAAGCTTGTGATGGCATTGGCACAGGA
TCATTGATGTCAGCTCAGACTGTGGATTCCAGTAACATTGACAAATTCATAAACTGTACC
AAGATCAATGGGAATTTGATCTTTCTAGTCACTGGTATTCATGGGGACCCTTACAATGCA
ATTGAAGCCATAGACCCAGAGAAACTGAACGTCTTTCGGACAGTCAGAGAGATAACAGGT
TTCCTGAACATACAGTCATGGCCACCAAACATGACTGACTTCAGTGTTTTTTCTAACCTG
GTGACCATTGGTGGAAGAGTACTCTATAGTGGCCTGTCCTTGCTTATCCTCAAGCAACAG
GGCATCACCTCTCTACAGTTCCAGTCCCTGAAGGAAATCAGCGCAGGAAACATCTATATT
ACTGACAACAGCAACCTGTGTTATTATCATACCATTAACTGGACAACACTCTTCAGCACA
ATCAACCAGAGAATAGTAATCCGGGACAACAGAAAAGCTGAAAATTGTACTGCTGAAGGA
ATGGTGTGCAACCATCTGTGTTCCAGTGATGGCTGTTGGGGACCTGGGCCAGACCAATGT
CTGTCGTGTCGCCGCTTCAGTAGAGGAAGGATCTGCATAGAGTCTTGTAACCTCTATGAT
GGTGAATTTCGGGAGTTTGAGAATGGCTCCATCTGTGTGGAGTGTGACCCCCAGTGTGAG
AAGATGGAAGATGGCCTCCTCACATGCCATGGACCGGGTCCTGACAACTGTACAAAGTGC
TCTCATTTTAAAGATGGCCCAAACTGTGTGGAAAAATGTCCAGATGGCTTACAGGGGGCA
AACAGTTTCATTTTCAAGTATGCTGATCCAGATCGGGAGTGCCACCCATGCCATCCAAAC
TGCACCCAAGGGTGTAACGGTCCCACTAGTCATGACTGCATTTACTACCCATGGACGGGC
CATTCCACTTTACCACAACATGCTAGAACTCCCCTGATTGCAGCTGGAGTAATTGGTGGG
CTCTTCATTCTGGTCATTGTGGGTCTGACATTTGCTGTTTATGTTAGAAGGAAGAGCATC
AAAAAGAAAAGAGCCTTGAGAAGATTCTTGGAAACAGAGTTGGTGGAACCATTAACTCCC
AGTGGCACAGCACCCAATCAAGCTCAACTTCGTATTTTGAAAGAAACTGAGCTGAAGAGG
GTAAAAGTCCTTGGCTCAGGTGCTTTTGGAACGGTTTATAAAGGTATTTGGGTACCTGAA
GGAGAAACTGTGAAGATTCCTGTGGCTATTAAGATTCTTAATGAGACAACTGGTCCCAAG
GCAAATGTGGAGTTCATGGATGAAGCTCTGATCATGGCAAGTATGGATCATCCACACCTA
GTCCGGTTGCTGGGTGTGTGTCTGAGCCCAACCATCCAGCTGGTTACTCAACTTATGCCC
CATGGCTGCCTGTTGGAGTATGTCCACGAGCACAAGGATAACATTGGATCACAACTGCTG
CTTAACTGGTGTGTCCAGATAGCTAAGGGAATGATGTACCTGGAAGAAAGACGACTCGTT
CATCGGGATTTGGCAGCCCGTAATGTCTTAGTGAAATCTCCAAACCATGTGAAAATCACA
GATTTTGGGCTAGCCAGACTCTTGGAAGGAGATGAAAAAGAGTACAATGCTGATGGAGGA
AAGATGCCAATTAAATGGATGGCTCTGGAGTGTATACATTACAGGAAATTCACCCATCAG
AGTGACGTTTGGAGCTATGGAGTTACTATATGGGAACTGATGACCTTTGGAGGAAAACCC
TATGATGGAATTCCAACGCGAGAAATCCCTGATTTATTAGAGAAAGGAGAACGTTTGCCT
CAGCCTCCCATCTGCACTATTGACGTTTACATGGTCATGGTCAAATGTTGGATGATTGAT
GCTGACAGTAGACCTAAATTTAAGGAACTGGCTGCTGAGTTTTCAAGGATGGCTCGAGAC
CCTCAAAGATACCTAGTTATTCAGGGTGATGATCGTATGAAGCTTCCCAGTCCAAATGAC
AGCAAGTTCTTTCAGAATCTCTTGGATGAAGAGGATTTGGAAGATATGATGGATGCTGAG
GAGTACTTGGTCCCTCAGGCTTTCAACATCCCACCTCCCATCTATACTTCCAGAGCAAGA
ATTGACTCGAATAGGAGTGAAATTGGACACAGCCCTCCTCCTGCCTACACCCCCATGTCA
GGAAACCAGTTTGTATACCGAGATGGAGGTTTTGCTGCTGAACAAGGAGTGTCTGTGCCC
TACAGAGCCCCAACTAGCACAATTCCAGAAGCTCCTGTGGCACAGGGTGCTACTGCTGAG
ATTTTTGATGACTCCTGCTGTAATGGCACCCTACGCAAGCCAGTGGCACCCCATGTCCAA
GAGGACAGTAGCACCCAGAGGTACAGTGCTGACCCCACCGTGTTTGCCCCAGAACGGAGC
CCACGAGGAGAGCTGGATGAGGAAGGTTACATGACTCCTATGCGAGACAAACCCAAACAA
GAATACCTGAATCCAGTGGAGGAGAACCCTTTTGTTTCTCGGAGAAAAAATGGAGACCTT
CAAGCATTGGATAATCCCGAATATCACAATGCATCCAATGGTCCACCCAAGGCCGAGGAT
GAGTATGTGAATGAGCCACTGTACCTCAACACCTTTGCCAACACCTTGGGAAAAGCTGAG
TACCTGAAGAACAACATACTGTCAATGCCAGAGAAGGCCAAGAAAGCGTTTGACAACCCT
GACTACTGGAACCACAGCCTGCCACCTCGGAGCACCCTTCAGCACCCAGACTACCTGCAG
GAGTACAGCACAAAATATTTTTATAAACAGAATGGGCGGATCCGGCCTATTGTGGCAGAG
AATCCTGAATACCTCTCTGAGTTCTCCCTGAAGCCAGGCACTGTGCTGCCGCCTCCACCT
TACAGACACCGGAATACTGTGGTGTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 3960
Start on reference sequence 34
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ERBB4
Symbol Nomenclature : ERBB4
SYNONYM : ALS19; HER4; p180erbB4
Designation : avian erythroblastic leukemia viral (v-erb-b2) oncogene homolog 4|proto-oncogene-like protein c-ErbB-4|receptor tyrosine-protein kinase erbB-4|tyrosine kinase-type cell surface receptor HER4|v-erb-a erythroblastic leukemia viral oncogene homolog 4
Full Nomenclature : v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4
GENEID : 2066
GI : 61354695
GenBank Accession : AY888098
HGNC : 3432
MIM : 600543
Vega : OTTHUMG00000133012
Target GenBank: NM_005235

 

Reference Sequence Alignment

  

HsCD00000109        ATGAAGCCGGCGACAGGACTTTGGGTCTGGGTGAGCCTTCTCGTGGCGGCGGGGACCGTC
NM_005235.2         ATGAAGCCGGCGACAGGACTTTGGGTCTGGGTGAGCCTTCTCGTGGCGGCGGGGACCGTC
XM_005246375.1      ATGAAGCCGGCGACAGGACTTTGGGTCTGGGTGAGCCTTCTCGTGGCGGCGGGGACCGTC
XM_005246376.1      ATGAAGCCGGCGACAGGACTTTGGGTCTGGGTGAGCCTTCTCGTGGCGGCGGGGACCGTC
NM_001042599.1      ATGAAGCCGGCGACAGGACTTTGGGTCTGGGTGAGCCTTCTCGTGGCGGCGGGGACCGTC
XM_005246377.1      ATGAAGCCGGCGACAGGACTTTGGGTCTGGGTGAGCCTTCTCGTGGCGGCGGGGACCGTC
                    ************************************************************

HsCD00000109        CAGCCCAGCGATTCTCAGTCAGTGTGTGCAGGAACGGAGAATAAACTGAGCTCTCTCTCT
NM_005235.2         CAGCCCAGCGATTCTCAGTCAGTGTGTGCAGGAACGGAGAATAAACTGAGCTCTCTCTCT
XM_005246375.1      CAGCCCAGCGATTCTCAGTCAGTGTGTGCAGGAACGGAGAATAAACTGAGCTCTCTCTCT
XM_005246376.1      CAGCCCAGCGATTCTCAGTCAGTGTGTGCAGGAACGGAGAATAAACTGAGCTCTCTCTCT
NM_001042599.1      CAGCCCAGCGATTCTCAGTCAGTGTGTGCAGGAACGGAGAATAAACTGAGCTCTCTCTCT
XM_005246377.1      CAGCCCAGCGATTCTCAGTCAGTGTGTGCAGGAACGGAGAATAAACTGAGCTCTCTCTCT
                    ************************************************************

HsCD00000109        GACCTGGAACAGCAGTACCGAGCCTTGCGCAAGTACTATGAAAACTGTGAGGTTGTCATG
NM_005235.2         GACCTGGAACAGCAGTACCGAGCCTTGCGCAAGTACTATGAAAACTGTGAGGTTGTCATG
XM_005246375.1      GACCTGGAACAGCAGTACCGAGCCTTGCGCAAGTACTATGAAAACTGTGAGGTTGTCATG
XM_005246376.1      GACCTGGAACAGCAGTACCGAGCCTTGCGCAAGTACTATGAAAACTGTGAGGTTGTCATG
NM_001042599.1      GACCTGGAACAGCAGTACCGAGCCTTGCGCAAGTACTATGAAAACTGTGAGGTTGTCATG
XM_005246377.1      GACCTGGAACAGCAGTACCGAGCCTTGCGCAAGTACTATGAAAACTGTGAGGTTGTCATG
                    ************************************************************

HsCD00000109        GGCAACCTGGAGATAACCAGCATTGAGCACAACCGGGACCTCTCCTTCCTGCGGTCTGTT
NM_005235.2         GGCAACCTGGAGATAACCAGCATTGAGCACAACCGGGACCTCTCCTTCCTGCGGTCTGTT
XM_005246375.1      GGCAACCTGGAGATAACCAGCATTGAGCACAACCGGGACCTCTCCTTCCTGCGGTCTGTT
XM_005246376.1      GGCAACCTGGAGATAACCAGCATTGAGCACAACCGGGACCTCTCCTTCCTGCGGTCTGTT
NM_001042599.1      GGCAACCTGGAGATAACCAGCATTGAGCACAACCGGGACCTCTCCTTCCTGCGGTCTGTT
XM_005246377.1      GGCAACCTGGAGATAACCAGCATTGAGCACAACCGGGACCTCTCCTTCCTGCGGTCTGTT
                    ************************************************************

HsCD00000109        CGAGAAGTCACAGGCTACGTGTTAGTGGCTCTTAATCAGTTTCGTTACCTGCCTCTGGAG
NM_005235.2         CGAGAAGTCACAGGCTACGTGTTAGTGGCTCTTAATCAGTTTCGTTACCTGCCTCTGGAG
XM_005246375.1      CGAGAAGTCACAGGCTACGTGTTAGTGGCTCTTAATCAGTTTCGTTACCTGCCTCTGGAG
XM_005246376.1      CGAGAAGTCACAGGCTACGTGTTAGTGGCTCTTAATCAGTTTCGTTACCTGCCTCTGGAG
NM_001042599.1      CGAGAAGTCACAGGCTACGTGTTAGTGGCTCTTAATCAGTTTCGTTACCTGCCTCTGGAG
XM_005246377.1      CGAGAAGTCACAGGCTACGTGTTAGTGGCTCTTAATCAGTTTCGTTACCTGCCTCTGGAG
                    ************************************************************

HsCD00000109        AATTTACGCATTATTCGTGGGACAAAACTTTATGAGGATCGATATGCCTTGGCAATATTT
NM_005235.2         AATTTACGCATTATTCGTGGGACAAAACTTTATGAGGATCGATATGCCTTGGCAATATTT
XM_005246375.1      AATTTACGCATTATTCGTGGGACAAAACTTTATGAGGATCGATATGCCTTGGCAATATTT
XM_005246376.1      AATTTACGCATTATTCGTGGGACAAAACTTTATGAGGATCGATATGCCTTGGCAATATTT
NM_001042599.1      AATTTACGCATTATTCGTGGGACAAAACTTTATGAGGATCGATATGCCTTGGCAATATTT
XM_005246377.1      AATTTACGCATTATTCGTGGGACAAAACTTTATGAGGATCGATATGCCTTGGCAATATTT
                    ************************************************************

HsCD00000109        TTAAACTACAGAAAAGATGGAAACTTTGGACTTCAAGAACTTGGATTAAAGAACTTGACA
NM_005235.2         TTAAACTACAGAAAAGATGGAAACTTTGGACTTCAAGAACTTGGATTAAAGAACTTGACA
XM_005246375.1      TTAAACTACAGAAAAGATGGAAACTTTGGACTTCAAGAACTTGGATTAAAGAACTTGACA
XM_005246376.1      TTAAACTACAGAAAAGATGGAAACTTTGGACTTCAAGAACTTGGATTAAAGAACTTGACA
NM_001042599.1      TTAAACTACAGAAAAGATGGAAACTTTGGACTTCAAGAACTTGGATTAAAGAACTTGACA
XM_005246377.1      TTAAACTACAGAAAAGATGGAAACTTTGGACTTCAAGAACTTGGATTAAAGAACTTGACA
                    ************************************************************

HsCD00000109        GAAATCCTAAATGGTGGAGTCTATGTAGACCAGAACAAATTCCTTTGTTATGCAGACACC
NM_005235.2         GAAATCCTAAATGGTGGAGTCTATGTAGACCAGAACAAATTCCTTTGTTATGCAGACACC
XM_005246375.1      GAAATCCTAAATGGTGGAGTCTATGTAGACCAGAACAAATTCCTTTGTTATGCAGACACC
XM_005246376.1      GAAATCCTAAATGGTGGAGTCTATGTAGACCAGAACAAATTCCTTTGTTATGCAGACACC
NM_001042599.1      GAAATCCTAAATGGTGGAGTCTATGTAGACCAGAACAAATTCCTTTGTTATGCAGACACC
XM_005246377.1      GAAATCCTAAATGGTGGAGTCTATGTAGACCAGAACAAATTCCTTTGTTATGCAGACACC
                    ************************************************************

HsCD00000109        ATTCATTGGCAAGATATTGTTCGGAACCCATGGCCTTCCAACTTGACTCTTGTGTCAACA
NM_005235.2         ATTCATTGGCAAGATATTGTTCGGAACCCATGGCCTTCCAACTTGACTCTTGTGTCAACA
XM_005246375.1      ATTCATTGGCAAGATATTGTTCGGAACCCATGGCCTTCCAACTTGACTCTTGTGTCAACA
XM_005246376.1      ATTCATTGGCAAGATATTGTTCGGAACCCATGGCCTTCCAACTTGACTCTTGTGTCAACA
NM_001042599.1      ATTCATTGGCAAGATATTGTTCGGAACCCATGGCCTTCCAACTTGACTCTTGTGTCAACA
XM_005246377.1      ATTCATTGGCAAGATATTGTTCGGAACCCATGGCCTTCCAACTTGACTCTTGTGTCAACA
                    ************************************************************

HsCD00000109        AATGGTAGTTCAGGATGTGGACGTTGCCATAAGTCCTGTACTGGCCGTTGCTGGGGACCC
NM_005235.2         AATGGTAGTTCAGGATGTGGACGTTGCCATAAGTCCTGTACTGGCCGTTGCTGGGGACCC
XM_005246375.1      AATGGTAGTTCAGGATGTGGACGTTGCCATAAGTCCTGTACTGGCCGTTGCTGGGGACCC
XM_005246376.1      AATGGTAGTTCAGGATGTGGACGTTGCCATAAGTCCTGTACTGGCCGTTGCTGGGGACCC
NM_001042599.1      AATGGTAGTTCAGGATGTGGACGTTGCCATAAGTCCTGTACTGGCCGTTGCTGGGGACCC
XM_005246377.1      AATGGTAGTTCAGGATGTGGACGTTGCCATAAGTCCTGTACTGGCCGTTGCTGGGGACCC
                    ************************************************************

HsCD00000109        ACAGAAAATCATTGCCAGACTTTGACAAGGACGGTGTGTGCAGAACAATGTGACGGCAGA
NM_005235.2         ACAGAAAATCATTGCCAGACTTTGACAAGGACGGTGTGTGCAGAACAATGTGACGGCAGA
XM_005246375.1      ACAGAAAATCATTGCCAGACTTTGACAAGGACGGTGTGTGCAGAACAATGTGACGGCAGA
XM_005246376.1      ACAGAAAATCATTGCCAGACTTTGACAAGGACGGTGTGTGCAGAACAATGTGACGGCAGA
NM_001042599.1      ACAGAAAATCATTGCCAGACTTTGACAAGGACGGTGTGTGCAGAACAATGTGACGGCAGA
XM_005246377.1      ACAGAAAATCATTGCCAGACTTTGACAAGGACGGTGTGTGCAGAACAATGTGACGGCAGA
                    ************************************************************

HsCD00000109        TGCTACGGACCTTACGTCAGTGACTGCTGCCATCGAGAATGTGCTGGAGGCTGCTCAGGA
NM_005235.2         TGCTACGGACCTTACGTCAGTGACTGCTGCCATCGAGAATGTGCTGGAGGCTGCTCAGGA
XM_005246375.1      TGCTACGGACCTTACGTCAGTGACTGCTGCCATCGAGAATGTGCTGGAGGCTGCTCAGGA
XM_005246376.1      TGCTACGGACCTTACGTCAGTGACTGCTGCCATCGAGAATGTGCTGGAGGCTGCTCAGGA
NM_001042599.1      TGCTACGGACCTTACGTCAGTGACTGCTGCCATCGAGAATGTGCTGGAGGCTGCTCAGGA
XM_005246377.1      TGCTACGGACCTTACGTCAGTGACTGCTGCCATCGAGAATGTGCTGGAGGCTGCTCAGGA
                    ************************************************************

HsCD00000109        CCTAAGGACACAGACTGCTTTGCCTGCATGAATTTCAATGACAGTGGAGCATGTGTTACT
NM_005235.2         CCTAAGGACACAGACTGCTTTGCCTGCATGAATTTCAATGACAGTGGAGCATGTGTTACT
XM_005246375.1      CCTAAGGACACAGACTGCTTTGCCTGCATGAATTTCAATGACAGTGGAGCATGTGTTACT
XM_005246376.1      CCTAAGGACACAGACTGCTTTGCCTGCATGAATTTCAATGACAGTGGAGCATGTGTTACT
NM_001042599.1      CCTAAGGACACAGACTGCTTTGCCTGCATGAATTTCAATGACAGTGGAGCATGTGTTACT
XM_005246377.1      CCTAAGGACACAGACTGCTTTGCCTGCATGAATTTCAATGACAGTGGAGCATGTGTTACT
                    ************************************************************

HsCD00000109        CAGTGTCCCCAAACCTTTGTCTACAATCCAACCACCTTTCAACTGGAGCACAATTTCAAT
NM_005235.2         CAGTGTCCCCAAACCTTTGTCTACAATCCAACCACCTTTCAACTGGAGCACAATTTCAAT
XM_005246375.1      CAGTGTCCCCAAACCTTTGTCTACAATCCAACCACCTTTCAACTGGAGCACAATTTCAAT
XM_005246376.1      CAGTGTCCCCAAACCTTTGTCTACAATCCAACCACCTTTCAACTGGAGCACAATTTCAAT
NM_001042599.1      CAGTGTCCCCAAACCTTTGTCTACAATCCAACCACCTTTCAACTGGAGCACAATTTCAAT
XM_005246377.1      CAGTGTCCCCAAACCTTTGTCTACAATCCAACCACCTTTCAACTGGAGCACAATTTCAAT
                    ************************************************************

HsCD00000109        GCAAAGTACACATATGGAGCATTCTGTGTCAAGAAATGTCCACATAACTTTGTGGTAGAT
NM_005235.2         GCAAAGTACACATATGGAGCATTCTGTGTCAAGAAATGTCCACATAACTTTGTGGTAGAT
XM_005246375.1      GCAAAGTACACATATGGAGCATTCTGTGTCAAGAAATGTCCACATAACTTTGTGGTAGAT
XM_005246376.1      GCAAAGTACACATATGGAGCATTCTGTGTCAAGAAATGTCCACATAACTTTGTGGTAGAT
NM_001042599.1      GCAAAGTACACATATGGAGCATTCTGTGTCAAGAAATGTCCACATAACTTTGTGGTAGAT
XM_005246377.1      GCAAAGTACACATATGGAGCATTCTGTGTCAAGAAATGTCCACATAACTTTGTGGTAGAT
                    ************************************************************

HsCD00000109        TCCAGTTCTTGTGTGCGTGCCTGCCCTAGTTCCAAGATGGAAGTAGAAGAAAATGGGATT
NM_005235.2         TCCAGTTCTTGTGTGCGTGCCTGCCCTAGTTCCAAGATGGAAGTAGAAGAAAATGGGATT
XM_005246375.1      TCCAGTTCTTGTGTGCGTGCCTGCCCTAGTTCCAAGATGGAAGTAGAAGAAAATGGGATT
XM_005246376.1      TCCAGTTCTTGTGTGCGTGCCTGCCCTAGTTCCAAGATGGAAGTAGAAGAAAATGGGATT
NM_001042599.1      TCCAGTTCTTGTGTGCGTGCCTGCCCTAGTTCCAAGATGGAAGTAGAAGAAAATGGGATT
XM_005246377.1      TCCAGTTCTTGTGTGCGTGCCTGCCCTAGTTCCAAGATGGAAGTAGAAGAAAATGGGATT
                    ************************************************************

HsCD00000109        AAAATGTGTAAACCTTGCACTGACATTTGCCCAAAAGCTTGTGATGGCATTGGCACAGGA
NM_005235.2         AAAATGTGTAAACCTTGCACTGACATTTGCCCAAAAGCTTGTGATGGCATTGGCACAGGA
XM_005246375.1      AAAATGTGTAAACCTTGCACTGACATTTGCCCAAAAGCTTGTGATGGCATTGGCACAGGA
XM_005246376.1      AAAATGTGTAAACCTTGCACTGACATTTGCCCAAAAGCTTGTGATGGCATTGGCACAGGA
NM_001042599.1      AAAATGTGTAAACCTTGCACTGACATTTGCCCAAAAGCTTGTGATGGCATTGGCACAGGA
XM_005246377.1      AAAATGTGTAAACCTTGCACTGACATTTGCCCAAAAGCTTGTGATGGCATTGGCACAGGA
                    ************************************************************

HsCD00000109        TCATTGATGTCAGCTCAGACTGTGGATTCCAGTAACATTGACAAATTCATAAACTGTACC
NM_005235.2         TCATTGATGTCAGCTCAGACTGTGGATTCCAGTAACATTGACAAATTCATAAACTGTACC
XM_005246375.1      TCATTGATGTCAGCTCAGACTGTGGATTCCAGTAACATTGACAAATTCATAAACTGTACC
XM_005246376.1      TCATTGATGTCAGCTCAGACTGTGGATTCCAGTAACATTGACAAATTCATAAACTGTACC
NM_001042599.1      TCATTGATGTCAGCTCAGACTGTGGATTCCAGTAACATTGACAAATTCATAAACTGTACC
XM_005246377.1      TCATTGATGTCAGCTCAGACTGTGGATTCCAGTAACATTGACAAATTCATAAACTGTACC
                    ************************************************************

HsCD00000109        AAGATCAATGGGAATTTGATCTTTCTAGTCACTGGTATTCATGGGGACCCTTACAATGCA
NM_005235.2         AAGATCAATGGGAATTTGATCTTTCTAGTCACTGGTATTCATGGGGACCCTTACAATGCA
XM_005246375.1      AAGATCAATGGGAATTTGATCTTTCTAGTCACTGGTATTCATGGGGACCCTTACAATGCA
XM_005246376.1      AAGATCAATGGGAATTTGATCTTTCTAGTCACTGGTATTCATGGGGACCCTTACAATGCA
NM_001042599.1      AAGATCAATGGGAATTTGATCTTTCTAGTCACTGGTATTCATGGGGACCCTTACAATGCA
XM_005246377.1      AAGATCAATGGGAATTTGATCTTTCTAGTCACTGGTATTCATGGGGACCCTTACAATGCA
                    ************************************************************

HsCD00000109        ATTGAAGCCATAGACCCAGAGAAACTGAACGTCTTTCGGACAGTCAGAGAGATAACAGGT
NM_005235.2         ATTGAAGCCATAGACCCAGAGAAACTGAACGTCTTTCGGACAGTCAGAGAGATAACAGGT
XM_005246375.1      ATTGAAGCCATAGACCCAGAGAAACTGAACGTCTTTCGGACAGTCAGAGAGATAACAGGT
XM_005246376.1      ATTGAAGCCATAGACCCAGAGAAACTGAACGTCTTTCGGACAGTCAGAGAGATAACAGGT
NM_001042599.1      ATTGAAGCCATAGACCCAGAGAAACTGAACGTCTTTCGGACAGTCAGAGAGATAACAGGT
XM_005246377.1      ATTGAAGCCATAGACCCAGAGAAACTGAACGTCTTTCGGACAGTCAGAGAGATAACAGGT
                    ************************************************************

HsCD00000109        TTCCTGAACATACAGTCATGGCCACCAAACATGACTGACTTCAGTGTTTTTTCTAACCTG
NM_005235.2         TTCCTGAACATACAGTCATGGCCACCAAACATGACTGACTTCAGTGTTTTTTCTAACCTG
XM_005246375.1      TTCCTGAACATACAGTCATGGCCACCAAACATGACTGACTTCAGTGTTTTTTCTAACCTG
XM_005246376.1      TTCCTGAACATACAGTCATGGCCACCAAACATGACTGACTTCAGTGTTTTTTCTAACCTG
NM_001042599.1      TTCCTGAACATACAGTCATGGCCACCAAACATGACTGACTTCAGTGTTTTTTCTAACCTG
XM_005246377.1      TTCCTGAACATACAGTCATGGCCACCAAACATGACTGACTTCAGTGTTTTTTCTAACCTG
                    ************************************************************

HsCD00000109        GTGACCATTGGTGGAAGAGTACTCTATAGTGGCCTGTCCTTGCTTATCCTCAAGCAACAG
NM_005235.2         GTGACCATTGGTGGAAGAGTACTCTATAGTGGCCTGTCCTTGCTTATCCTCAAGCAACAG
XM_005246375.1      GTGACCATTGGTGGAAGAGTACTCTATAGTGGCCTGTCCTTGCTTATCCTCAAGCAACAG
XM_005246376.1      GTGACCATTGGTGGAAGAGTACTCTATAGTGGCCTGTCCTTGCTTATCCTCAAGCAACAG
NM_001042599.1      GTGACCATTGGTGGAAGAGTACTCTATAGTGGCCTGTCCTTGCTTATCCTCAAGCAACAG
XM_005246377.1      GTGACCATTGGTGGAAGAGTACTCTATAGTGGCCTGTCCTTGCTTATCCTCAAGCAACAG
                    ************************************************************

HsCD00000109        GGCATCACCTCTCTACAGTTCCAGTCCCTGAAGGAAATCAGCGCAGGAAACATCTATATT
NM_005235.2         GGCATCACCTCTCTACAGTTCCAGTCCCTGAAGGAAATCAGCGCAGGAAACATCTATATT
XM_005246375.1      GGCATCACCTCTCTACAGTTCCAGTCCCTGAAGGAAATCAGCGCAGGAAACATCTATATT
XM_005246376.1      GGCATCACCTCTCTACAGTTCCAGTCCCTGAAGGAAATCAGCGCAGGAAACATCTATATT
NM_001042599.1      GGCATCACCTCTCTACAGTTCCAGTCCCTGAAGGAAATCAGCGCAGGAAACATCTATATT
XM_005246377.1      GGCATCACCTCTCTACAGTTCCAGTCCCTGAAGGAAATCAGCGCAGGAAACATCTATATT
                    ************************************************************

HsCD00000109        ACTGACAACAGCAACCTGTGTTATTATCATACCATTAACTGGACAACACTCTTCAGCACA
NM_005235.2         ACTGACAACAGCAACCTGTGTTATTATCATACCATTAACTGGACAACACTCTTCAGCACA
XM_005246375.1      ACTGACAACAGCAACCTGTGTTATTATCATACCATTAACTGGACAACACTCTTCAGCACA
XM_005246376.1      ACTGACAACAGCAACCTGTGTTATTATCATACCATTAACTGGACAACACTCTTCAGCACA
NM_001042599.1      ACTGACAACAGCAACCTGTGTTATTATCATACCATTAACTGGACAACACTCTTCAGCACA
XM_005246377.1      ACTGACAACAGCAACCTGTGTTATTATCATACCATTAACTGGACAACACTCTTCAGCACA
                    ************************************************************

HsCD00000109        ATCAACCAGAGAATAGTAATCCGGGACAACAGAAAAGCTGAAAATTGTACTGCTGAAGGA
NM_005235.2         ATCAACCAGAGAATAGTAATCCGGGACAACAGAAAAGCTGAAAATTGTACTGCTGAAGGA
XM_005246375.1      ATCAACCAGAGAATAGTAATCCGGGACAACAGAAAAGCTGAAAATTGTACTGCTGAAGGA
XM_005246376.1      ATCAACCAGAGAATAGTAATCCGGGACAACAGAAAAGCTGAAAATTGTACTGCTGAAGGA
NM_001042599.1      ATCAACCAGAGAATAGTAATCCGGGACAACAGAAAAGCTGAAAATTGTACTGCTGAAGGA
XM_005246377.1      ATCAACCAGAGAATAGTAATCCGGGACAACAGAAAAGCTGAAAATTGTACTGCTGAAGGA
                    ************************************************************

HsCD00000109        ATGGTGTGCAACCATCTGTGTTCCAGTGATGGCTGTTGGGGACCTGGGCCAGACCAATGT
NM_005235.2         ATGGTGTGCAACCATCTGTGTTCCAGTGATGGCTGTTGGGGACCTGGGCCAGACCAATGT
XM_005246375.1      ATGGTGTGCAACCATCTGTGTTCCAGTGATGGCTGTTGGGGACCTGGGCCAGACCAATGT
XM_005246376.1      ATGGTGTGCAACCATCTGTGTTCCAGTGATGGCTGTTGGGGACCTGGGCCAGACCAATGT
NM_001042599.1      ATGGTGTGCAACCATCTGTGTTCCAGTGATGGCTGTTGGGGACCTGGGCCAGACCAATGT
XM_005246377.1      ATGGTGTGCAACCATCTGTGTTCCAGTGATGGCTGTTGGGGACCTGGGCCAGACCAATGT
                    ************************************************************

HsCD00000109        CTGTCGTGTCGCCGCTTCAGTAGAGGAAGGATCTGCATAGAGTCTTGTAACCTCTATGAT
NM_005235.2         CTGTCGTGTCGCCGCTTCAGTAGAGGAAGGATCTGCATAGAGTCTTGTAACCTCTATGAT
XM_005246375.1      CTGTCGTGTCGCCGCTTCAGTAGAGGAAGGATCTGCATAGAGTCTTGTAACCTCTATGAT
XM_005246376.1      CTGTCGTGTCGCCGCTTCAGTAGAGGAAGGATCTGCATAGAGTCTTGTAACCTCTATGAT
NM_001042599.1      CTGTCGTGTCGCCGCTTCAGTAGAGGAAGGATCTGCATAGAGTCTTGTAACCTCTATGAT
XM_005246377.1      CTGTCGTGTCGCCGCTTCAGTAGAGGAAGGATCTGCATAGAGTCTTGTAACCTCTATGAT
                    ************************************************************

HsCD00000109        GGTGAATTTCGGGAGTTTGAGAATGGCTCCATCTGTGTGGAGTGTGACCCCCAGTGTGAG
NM_005235.2         GGTGAATTTCGGGAGTTTGAGAATGGCTCCATCTGTGTGGAGTGTGACCCCCAGTGTGAG
XM_005246375.1      GGTGAATTTCGGGAGTTTGAGAATGGCTCCATCTGTGTGGAGTGTGACCCCCAGTGTGAG
XM_005246376.1      GGTGAATTTCGGGAGTTTGAGAATGGCTCCATCTGTGTGGAGTGTGACCCCCAGTGTGAG
NM_001042599.1      GGTGAATTTCGGGAGTTTGAGAATGGCTCCATCTGTGTGGAGTGTGACCCCCAGTGTGAG
XM_005246377.1      GGTGAATTTCGGGAGTTTGAGAATGGCTCCATCTGTGTGGAGTGTGACCCCCAGTGTGAG
                    ************************************************************

HsCD00000109        AAGATGGAAGATGGCCTCCTCACATGCCATGGACCGGGTCCTGACAACTGTACAAAGTGC
NM_005235.2         AAGATGGAAGATGGCCTCCTCACATGCCATGGACCGGGTCCTGACAACTGTACAAAGTGC
XM_005246375.1      AAGATGGAAGATGGCCTCCTCACATGCCATGGACCGGGTCCTGACAACTGTACAAAGTGC
XM_005246376.1      AAGATGGAAGATGGCCTCCTCACATGCCATGGACCGGGTCCTGACAACTGTACAAAGTGC
NM_001042599.1      AAGATGGAAGATGGCCTCCTCACATGCCATGGACCGGGTCCTGACAACTGTACAAAGTGC
XM_005246377.1      AAGATGGAAGATGGCCTCCTCACATGCCATGGACCGGGTCCTGACAACTGTACAAAGTGC
                    ************************************************************

HsCD00000109        TCTCATTTTAAAGATGGCCCAAACTGTGTGGAAAAATGTCCAGATGGCTTACAGGGGGCA
NM_005235.2         TCTCATTTTAAAGATGGCCCAAACTGTGTGGAAAAATGTCCAGATGGCTTACAGGGGGCA
XM_005246375.1      TCTCATTTTAAAGATGGCCCAAACTGTGTGGAAAAATGTCCAGATGGCTTACAGGGGGCA
XM_005246376.1      TCTCATTTTAAAGATGGCCCAAACTGTGTGGAAAAATGTCCAGATGGCTTACAGGGGGCA
NM_001042599.1      TCTCATTTTAAAGATGGCCCAAACTGTGTGGAAAAATGTCCAGATGGCTTACAGGGGGCA
XM_005246377.1      TCTCATTTTAAAGATGGCCCAAACTGTGTGGAAAAATGTCCAGATGGCTTACAGGGGGCA
                    ************************************************************

HsCD00000109        AACAGTTTCATTTTCAAGTATGCTGATCCAGATCGGGAGTGCCACCCATGCCATCCAAAC
NM_005235.2         AACAGTTTCATTTTCAAGTATGCTGATCCAGATCGGGAGTGCCACCCATGCCATCCAAAC
XM_005246375.1      AACAGTTTCATTTTCAAGTATGCTGATCCAGATCGGGAGTGCCACCCATGCCATCCAAAC
XM_005246376.1      AACAGTTTCATTTTCAAGTATGCTGATCCAGATCGGGAGTGCCACCCATGCCATCCAAAC
NM_001042599.1      AACAGTTTCATTTTCAAGTATGCTGATCCAGATCGGGAGTGCCACCCATGCCATCCAAAC
XM_005246377.1      AACAGTTTCATTTTCAAGTATGCTGATCCAGATCGGGAGTGCCACCCATGCCATCCAAAC
                    ************************************************************

HsCD00000109        TGCACCCAAGG---------------------------------------------GTGT
NM_005235.2         TGCACCCAAGG---------------------------------------------GTGT
XM_005246375.1      TGCACCCAAGGGTGCATAGGCTCAAGTATTGAAGACTGCATCGGCCTGATGGATAGGTGT
XM_005246376.1      TGCACCCAAGG---------------------------------------------GTGC
NM_001042599.1      TGCACCCAAGG---------------------------------------------GTGT
XM_005246377.1      TGCACCCAAGG---------------------------------------------GTGC
                    ***********                                             *** 

HsCD00000109        AACGGTCCCACTAGTCATGACTGCATTTACTACCCATGGACGGGCCATTCCACTTTACCA
NM_005235.2         AACGGTCCCACTAGTCATGACTGCATTTACTACCCATGGACGGGCCATTCCACTTTACCA
XM_005246375.1      AACGGTCCCACTAGTCATGACTGCATTTACTACCCATGGACGGGCCATTCCACTTTACCA
XM_005246376.1      ATAGGCTCAAGTATTGAAGACTGCATCGGCCTGATGG-----------------------
NM_001042599.1      AACGGTCCCACTAGTCATGACTGCATTTACTACCCATGGACGGGCCATTCCACTTTACCA
XM_005246377.1      ATAGGCTCAAGTATTGAAGACTGCATCGGCCTGATGG-----------------------
                    *:.**  *.* ** * *:********  .* : . .                        

HsCD00000109        CAACATGCTAGAACTCCCCTGATTGCAGCTGGAGTAATTGGTGGGCTCTTCATTCTGGTC
NM_005235.2         CAACATGCTAGAACTCCCCTGATTGCAGCTGGAGTAATTGGTGGGCTCTTCATTCTGGTC
XM_005246375.1      CAACATGCTAGAACTCCCCTGATTGCAGCTGGAGTAATTGGTGGGCTCTTCATTCTGGTC
XM_005246376.1      -------ATAGAACTCCCCTGATTGCAGCTGGAGTAATTGGTGGGCTCTTCATTCTGGTC
NM_001042599.1      CAACATGCTAGAACTCCCCTGATTGCAGCTGGAGTAATTGGTGGGCTCTTCATTCTGGTC
XM_005246377.1      -------ATAGAACTCCCCTGATTGCAGCTGGAGTAATTGGTGGGCTCTTCATTCTGGTC
                           .****************************************************

HsCD00000109        ATTGTGGGTCTGACATTTGCTGTTTATGTTAGAAGGAAGAGCATCAAAAAGAAAAGAGCC
NM_005235.2         ATTGTGGGTCTGACATTTGCTGTTTATGTTAGAAGGAAGAGCATCAAAAAGAAAAGAGCC
XM_005246375.1      ATTGTGGGTCTGACATTTGCTGTTTATGTTAGAAGGAAGAGCATCAAAAAGAAAAGAGCC
XM_005246376.1      ATTGTGGGTCTGACATTTGCTGTTTATGTTAGAAGGAAGAGCATCAAAAAGAAAAGAGCC
NM_001042599.1      ATTGTGGGTCTGACATTTGCTGTTTATGTTAGAAGGAAGAGCATCAAAAAGAAAAGAGCC
XM_005246377.1      ATTGTGGGTCTGACATTTGCTGTTTATGTTAGAAGGAAGAGCATCAAAAAGAAAAGAGCC
                    ************************************************************

HsCD00000109        TTGAGAAGATTCTTGGAAACAGAGTTGGTGGAACCATTAACTCCCAGTGGCACAGCACCC
NM_005235.2         TTGAGAAGATTCTTGGAAACAGAGTTGGTGGAACCATTAACTCCCAGTGGCACAGCACCC
XM_005246375.1      TTGAGAAGATTCTTGGAAACAGAGTTGGTGGAACCATTAACTCCCAGTGGCACAGCACCC
XM_005246376.1      TTGAGAAGATTCTTGGAAACAGAGTTGGTGGAACCATTAACTCCCAGTGGCACAGCACCC
NM_001042599.1      TTGAGAAGATTCTTGGAAACAGAGTTGGTGGAACCATTAACTCCCAGTGGCACAGCACCC
XM_005246377.1      TTGAGAAGATTCTTGGAAACAGAGTTGGTGGAACCATTAACTCCCAGTGGCACAGCACCC
                    ************************************************************

HsCD00000109        AATCAAGCTCAACTTCGTATTTTGAAAGAAACTGAGCTGAAGAGGGTAAAAGTCCTTGGC
NM_005235.2         AATCAAGCTCAACTTCGTATTTTGAAAGAAACTGAGCTGAAGAGGGTAAAAGTCCTTGGC
XM_005246375.1      AATCAAGCTCAACTTCGTATTTTGAAAGAAACTGAGCTGAAGAGGGTAAAAGTCCTTGGC
XM_005246376.1      AATCAAGCTCAACTTCGTATTTTGAAAGAAACTGAGCTGAAGAGGGTAAAAGTCCTTGGC
NM_001042599.1      AATCAAGCTCAACTTCGTATTTTGAAAGAAACTGAGCTGAAGAGGGTAAAAGTCCTTGGC
XM_005246377.1      AATCAAGCTCAACTTCGTATTTTGAAAGAAACTGAGCTGAAGAGGGTAAAAGTCCTTGGC
                    ************************************************************

HsCD00000109        TCAGGTGCTTTTGGAACGGTTTATAAAGGTATTTGGGTACCTGAAGGAGAAACTGTGAAG
NM_005235.2         TCAGGTGCTTTTGGAACGGTTTATAAAGGTATTTGGGTACCTGAAGGAGAAACTGTGAAG
XM_005246375.1      TCAGGTGCTTTTGGAACGGTTTATAAAGGTATTTGGGTACCTGAAGGAGAAACTGTGAAG
XM_005246376.1      TCAGGTGCTTTTGGAACGGTTTATAAAGGTATTTGGGTACCTGAAGGAGAAACTGTGAAG
NM_001042599.1      TCAGGTGCTTTTGGAACGGTTTATAAAGGTATTTGGGTACCTGAAGGAGAAACTGTGAAG
XM_005246377.1      TCAGGTGCTTTTGGAACGGTTTATAAAGGTATTTGGGTACCTGAAGGAGAAACTGTGAAG
                    ************************************************************

HsCD00000109        ATTCCTGTGGCTATTAAGATTCTTAATGAGACAACTGGTCCCAAGGCAAATGTGGAGTTC
NM_005235.2         ATTCCTGTGGCTATTAAGATTCTTAATGAGACAACTGGTCCCAAGGCAAATGTGGAGTTC
XM_005246375.1      ATTCCTGTGGCTATTAAGATTCTTAATGAGACAACTGGTCCCAAGGCAAATGTGGAGTTC
XM_005246376.1      ATTCCTGTGGCTATTAAGATTCTTAATGAGACAACTGGTCCCAAGGCAAATGTGGAGTTC
NM_001042599.1      ATTCCTGTGGCTATTAAGATTCTTAATGAGACAACTGGTCCCAAGGCAAATGTGGAGTTC
XM_005246377.1      ATTCCTGTGGCTATTAAGATTCTTAATGAGACAACTGGTCCCAAGGCAAATGTGGAGTTC
                    ************************************************************

HsCD00000109        ATGGATGAAGCTCTGATCATGGCAAGTATGGATCATCCACACCTAGTCCGGTTGCTGGGT
NM_005235.2         ATGGATGAAGCTCTGATCATGGCAAGTATGGATCATCCACACCTAGTCCGGTTGCTGGGT
XM_005246375.1      ATGGATGAAGCTCTGATCATGGCAAGTATGGATCATCCACACCTAGTCCGGTTGCTGGGT
XM_005246376.1      ATGGATGAAGCTCTGATCATGGCAAGTATGGATCATCCACACCTAGTCCGGTTGCTGGGT
NM_001042599.1      ATGGATGAAGCTCTGATCATGGCAAGTATGGATCATCCACACCTAGTCCGGTTGCTGGGT
XM_005246377.1      ATGGATGAAGCTCTGATCATGGCAAGTATGGATCATCCACACCTAGTCCGGTTGCTGGGT
                    ************************************************************

HsCD00000109        GTGTGTCTGAGCCCAACCATCCAGCTGGTTACTCAACTTATGCCCCATGGCTGCCTGTTG
NM_005235.2         GTGTGTCTGAGCCCAACCATCCAGCTGGTTACTCAACTTATGCCCCATGGCTGCCTGTTG
XM_005246375.1      GTGTGTCTGAGCCCAACCATCCAGCTGGTTACTCAACTTATGCCCCATGGCTGCCTGTTG
XM_005246376.1      GTGTGTCTGAGCCCAACCATCCAGCTGGTTACTCAACTTATGCCCCATGGCTGCCTGTTG
NM_001042599.1      GTGTGTCTGAGCCCAACCATCCAGCTGGTTACTCAACTTATGCCCCATGGCTGCCTGTTG
XM_005246377.1      GTGTGTCTGAGCCCAACCATCCAGCTGGTTACTCAACTTATGCCCCATGGCTGCCTGTTG
                    ************************************************************

HsCD00000109        GAGTATGTCCACGAGCACAAGGATAACATTGGATCACAACTGCTGCTTAACTGGTGTGTC
NM_005235.2         GAGTATGTCCACGAGCACAAGGATAACATTGGATCACAACTGCTGCTTAACTGGTGTGTC
XM_005246375.1      GAGTATGTCCACGAGCACAAGGATAACATTGGATCACAACTGCTGCTTAACTGGTGTGTC
XM_005246376.1      GAGTATGTCCACGAGCACAAGGATAACATTGGATCACAACTGCTGCTTAACTGGTGTGTC
NM_001042599.1      GAGTATGTCCACGAGCACAAGGATAACATTGGATCACAACTGCTGCTTAACTGGTGTGTC
XM_005246377.1      GAGTATGTCCACGAGCACAAGGATAACATTGGATCACAACTGCTGCTTAACTGGTGTGTC
                    ************************************************************

HsCD00000109        CAGATAGCTAAGGGAATGATGTACCTGGAAGAAAGACGACTCGTTCATCGGGATTTGGCA
NM_005235.2         CAGATAGCTAAGGGAATGATGTACCTGGAAGAAAGACGACTCGTTCATCGGGATTTGGCA
XM_005246375.1      CAGATAGCTAAGGGAATGATGTACCTGGAAGAAAGACGACTCGTTCATCGGGATTTGGCA
XM_005246376.1      CAGATAGCTAAGGGAATGATGTACCTGGAAGAAAGACGACTCGTTCATCGGGATTTGGCA
NM_001042599.1      CAGATAGCTAAGGGAATGATGTACCTGGAAGAAAGACGACTCGTTCATCGGGATTTGGCA
XM_005246377.1      CAGATAGCTAAGGGAATGATGTACCTGGAAGAAAGACGACTCGTTCATCGGGATTTGGCA
                    ************************************************************

HsCD00000109        GCCCGTAATGTCTTAGTGAAATCTCCAAACCATGTGAAAATCACAGATTTTGGGCTAGCC
NM_005235.2         GCCCGTAATGTCTTAGTGAAATCTCCAAACCATGTGAAAATCACAGATTTTGGGCTAGCC
XM_005246375.1      GCCCGTAATGTCTTAGTGAAATCTCCAAACCATGTGAAAATCACAGATTTTGGGCTAGCC
XM_005246376.1      GCCCGTAATGTCTTAGTGAAATCTCCAAACCATGTGAAAATCACAGATTTTGGGCTAGCC
NM_001042599.1      GCCCGTAATGTCTTAGTGAAATCTCCAAACCATGTGAAAATCACAGATTTTGGGCTAGCC
XM_005246377.1      GCCCGTAATGTCTTAGTGAAATCTCCAAACCATGTGAAAATCACAGATTTTGGGCTAGCC
                    ************************************************************

HsCD00000109        AGACTCTTGGAAGGAGATGAAAAAGAGTACAATGCTGATGGAGGAAAGATGCCAATTAAA
NM_005235.2         AGACTCTTGGAAGGAGATGAAAAAGAGTACAATGCTGATGGAGGAAAGATGCCAATTAAA
XM_005246375.1      AGACTCTTGGAAGGAGATGAAAAAGAGTACAATGCTGATGGAGGAAAGATGCCAATTAAA
XM_005246376.1      AGACTCTTGGAAGGAGATGAAAAAGAGTACAATGCTGATGGAGGAAAGATGCCAATTAAA
NM_001042599.1      AGACTCTTGGAAGGAGATGAAAAAGAGTACAATGCTGATGGAGGAAAGATGCCAATTAAA
XM_005246377.1      AGACTCTTGGAAGGAGATGAAAAAGAGTACAATGCTGATGGAGGAAAGATGCCAATTAAA
                    ************************************************************

HsCD00000109        TGGATGGCTCTGGAGTGTATACATTACAGGAAATTCACCCATCAGAGTGACGTTTGGAGC
NM_005235.2         TGGATGGCTCTGGAGTGTATACATTACAGGAAATTCACCCATCAGAGTGACGTTTGGAGC
XM_005246375.1      TGGATGGCTCTGGAGTGTATACATTACAGGAAATTCACCCATCAGAGTGACGTTTGGAGC
XM_005246376.1      TGGATGGCTCTGGAGTGTATACATTACAGGAAATTCACCCATCAGAGTGACGTTTGGAGC
NM_001042599.1      TGGATGGCTCTGGAGTGTATACATTACAGGAAATTCACCCATCAGAGTGACGTTTGGAGC
XM_005246377.1      TGGATGGCTCTGGAGTGTATACATTACAGGAAATTCACCCATCAGAGTGACGTTTGGAGC
                    ************************************************************

HsCD00000109        TATGGAGTTACTATATGGGAACTGATGACCTTTGGAGGAAAACCCTATGATGGAATTCCA
NM_005235.2         TATGGAGTTACTATATGGGAACTGATGACCTTTGGAGGAAAACCCTATGATGGAATTCCA
XM_005246375.1      TATGGAGTTACTATATGGGAACTGATGACCTTTGGAGGAAAACCCTATGATGGAATTCCA
XM_005246376.1      TATGGAGTTACTATATGGGAACTGATGACCTTTGGAGGAAAACCCTATGATGGAATTCCA
NM_001042599.1      TATGGAGTTACTATATGGGAACTGATGACCTTTGGAGGAAAACCCTATGATGGAATTCCA
XM_005246377.1      TATGGAGTTACTATATGGGAACTGATGACCTTTGGAGGAAAACCCTATGATGGAATTCCA
                    ************************************************************

HsCD00000109        ACGCGAGAAATCCCTGATTTATTAGAGAAAGGAGAACGTTTGCCTCAGCCTCCCATCTGC
NM_005235.2         ACGCGAGAAATCCCTGATTTATTAGAGAAAGGAGAACGTTTGCCTCAGCCTCCCATCTGC
XM_005246375.1      ACGCGAGAAATCCCTGATTTATTAGAGAAAGGAGAACGTTTGCCTCAGCCTCCCATCTGC
XM_005246376.1      ACGCGAGAAATCCCTGATTTATTAGAGAAAGGAGAACGTTTGCCTCAGCCTCCCATCTGC
NM_001042599.1      ACGCGAGAAATCCCTGATTTATTAGAGAAAGGAGAACGTTTGCCTCAGCCTCCCATCTGC
XM_005246377.1      ACGCGAGAAATCCCTGATTTATTAGAGAAAGGAGAACGTTTGCCTCAGCCTCCCATCTGC
                    ************************************************************

HsCD00000109        ACTATTGACGTTTACATGGTCATGGTCAAATGTTGGATGATTGATGCTGACAGTAGACCT
NM_005235.2         ACTATTGACGTTTACATGGTCATGGTCAAATGTTGGATGATTGATGCTGACAGTAGACCT
XM_005246375.1      ACTATTGACGTTTACATGGTCATGGTCAAATGTTGGATGATTGATGCTGACAGTAGACCT
XM_005246376.1      ACTATTGACGTTTACATGGTCATGGTCAAATGTTGGATGATTGATGCTGACAGTAGACCT
NM_001042599.1      ACTATTGACGTTTACATGGTCATGGTCAAATGTTGGATGATTGATGCTGACAGTAGACCT
XM_005246377.1      ACTATTGACGTTTACATGGTCATGGTCAAATGTTGGATGATTGATGCTGACAGTAGACCT
                    ************************************************************

HsCD00000109        AAATTTAAGGAACTGGCTGCTGAGTTTTCAAGGATGGCTCGAGACCCTCAAAGATACCTA
NM_005235.2         AAATTTAAGGAACTGGCTGCTGAGTTTTCAAGGATGGCTCGAGACCCTCAAAGATACCTA
XM_005246375.1      AAATTTAAGGAACTGGCTGCTGAGTTTTCAAGGATGGCTCGAGACCCTCAAAGATACCTA
XM_005246376.1      AAATTTAAGGAACTGGCTGCTGAGTTTTCAAGGATGGCTCGAGACCCTCAAAGATACCTA
NM_001042599.1      AAATTTAAGGAACTGGCTGCTGAGTTTTCAAGGATGGCTCGAGACCCTCAAAGATACCTA
XM_005246377.1      AAATTTAAGGAACTGGCTGCTGAGTTTTCAAGGATGGCTCGAGACCCTCAAAGATACCTA
                    ************************************************************

HsCD00000109        GTTATTCAGGGTGATGATCGTATGAAGCTTCCCAGTCCAAATGACAGCAAGTTCTTTCAG
NM_005235.2         GTTATTCAGGGTGATGATCGTATGAAGCTTCCCAGTCCAAATGACAGCAAGTTCTTTCAG
XM_005246375.1      GTTATTCAGGGTGATGATCGTATGAAGCTTCCCAGTCCAAATGACAGCAAGTTCTTTCAG
XM_005246376.1      GTTATTCAGGGTGATGATCGTATGAAGCTTCCCAGTCCAAATGACAGCAAGTTCTTTCAG
NM_001042599.1      GTTATTCAGGGTGATGATCGTATGAAGCTTCCCAGTCCAAATGACAGCAAGTTCTTTCAG
XM_005246377.1      GTTATTCAGGGTGATGATCGTATGAAGCTTCCCAGTCCAAATGACAGCAAGTTCTTTCAG
                    ************************************************************

HsCD00000109        AATCTCTTGGATGAAGAGGATTTGGAAGATATGATGGATGCTGAGGAGTACTTGGTCCCT
NM_005235.2         AATCTCTTGGATGAAGAGGATTTGGAAGATATGATGGATGCTGAGGAGTACTTGGTCCCT
XM_005246375.1      AATCTCTTGGATGAAGAGGATTTGGAAGATATGATGGATGCTGAGGAGTACTTGGTCCCT
XM_005246376.1      AATCTCTTGGATGAAGAGGATTTGGAAGATATGATGGATGCTGAGGAGTACTTGGTCCCT
NM_001042599.1      AATCTCTTGGATGAAGAGGATTTGGAAGATATGATGGATGCTGAGGAGTACTTGGTCCCT
XM_005246377.1      AATCTCTTGGATGAAGAGGATTTGGAAGATATGATGGATGCTGAGGAGTACTTGGTCCCT
                    ************************************************************

HsCD00000109        CAGGCTTTCAACATCCCACCTCCCATCTATACTTCCAGAGCAAGAATTGACTCGAATAGG
NM_005235.2         CAGGCTTTCAACATCCCACCTCCCATCTATACTTCCAGAGCAAGAATTGACTCGAATAGG
XM_005246375.1      CAGGCTTTCAACATCCCACCTCCCATCTATACTTCCAGAGCAAGAATTGACTCGAATAG-
XM_005246376.1      CAGGCTTTCAACATCCCACCTCCCATCTATACTTCCAGAGCAAGAATTGACTCGAATAGG
NM_001042599.1      CAGGCTTTCAACATCCCACCTCCCATCTATACTTCCAGAGCAAGAATTGACTCGAATAG-
XM_005246377.1      CAGGCTTTCAACATCCCACCTCCCATCTATACTTCCAGAGCAAGAATTGACTCGAATAG-
                    *********************************************************** 

HsCD00000109        AGTGAAATTGGACACAGCCCTCCTCCTGCCTACACCCCCATGTCAGGAAACCAGTTTGTA
NM_005235.2         AGTGAAATTGGACACAGCCCTCCTCCTGCCTACACCCCCATGTCAGGAAACCAGTTTGTA
XM_005246375.1      -----------------------------------------------GAACCAGTTTGTA
XM_005246376.1      AGTGAAATTGGACACAGCCCTCCTCCTGCCTACACCCCCATGTCAGGAAACCAGTTTGTA
NM_001042599.1      -----------------------------------------------GAACCAGTTTGTA
XM_005246377.1      -----------------------------------------------GAACCAGTTTGTA
                                                                   .************

HsCD00000109        TACCGAGATGGAGGTTTTGCTGCTGAACAAGGAGTGTCTGTGCCCTACAGAGCCCCAACT
NM_005235.2         TACCGAGATGGAGGTTTTGCTGCTGAACAAGGAGTGTCTGTGCCCTACAGAGCCCCAACT
XM_005246375.1      TACCGAGATGGAGGTTTTGCTGCTGAACAAGGAGTGTCTGTGCCCTACAGAGCCCCAACT
XM_005246376.1      TACCGAGATGGAGGTTTTGCTGCTGAACAAGGAGTGTCTGTGCCCTACAGAGCCCCAACT
NM_001042599.1      TACCGAGATGGAGGTTTTGCTGCTGAACAAGGAGTGTCTGTGCCCTACAGAGCCCCAACT
XM_005246377.1      TACCGAGATGGAGGTTTTGCTGCTGAACAAGGAGTGTCTGTGCCCTACAGAGCCCCAACT
                    ************************************************************

HsCD00000109        AGCACAATTCCAGAAGCTCCTGTGGCACAGGGTGCTACTGCTGAGATTTTTGATGACTCC
NM_005235.2         AGCACAATTCCAGAAGCTCCTGTGGCACAGGGTGCTACTGCTGAGATTTTTGATGACTCC
XM_005246375.1      AGCACAATTCCAGAAGCTCCTGTGGCACAGGGTGCTACTGCTGAGATTTTTGATGACTCC
XM_005246376.1      AGCACAATTCCAGAAGCTCCTGTGGCACAGGGTGCTACTGCTGAGATTTTTGATGACTCC
NM_001042599.1      AGCACAATTCCAGAAGCTCCTGTGGCACAGGGTGCTACTGCTGAGATTTTTGATGACTCC
XM_005246377.1      AGCACAATTCCAGAAGCTCCTGTGGCACAGGGTGCTACTGCTGAGATTTTTGATGACTCC
                    ************************************************************

HsCD00000109        TGCTGTAATGGCACCCTACGCAAGCCAGTGGCACCCCATGTCCAAGAGGACAGTAGCACC
NM_005235.2         TGCTGTAATGGCACCCTACGCAAGCCAGTGGCACCCCATGTCCAAGAGGACAGTAGCACC
XM_005246375.1      TGCTGTAATGGCACCCTACGCAAGCCAGTGGCACCCCATGTCCAAGAGGACAGTAGCACC
XM_005246376.1      TGCTGTAATGGCACCCTACGCAAGCCAGTGGCACCCCATGTCCAAGAGGACAGTAGCACC
NM_001042599.1      TGCTGTAATGGCACCCTACGCAAGCCAGTGGCACCCCATGTCCAAGAGGACAGTAGCACC
XM_005246377.1      TGCTGTAATGGCACCCTACGCAAGCCAGTGGCACCCCATGTCCAAGAGGACAGTAGCACC
                    ************************************************************

HsCD00000109        CAGAGGTACAGTGCTGACCCCACCGTGTTTGCCCCAGAACGGAGCCCACGAGGAGAGCTG
NM_005235.2         CAGAGGTACAGTGCTGACCCCACCGTGTTTGCCCCAGAACGGAGCCCACGAGGAGAGCTG
XM_005246375.1      CAGAGGTACAGTGCTGACCCCACCGTGTTTGCCCCAGAACGGAGCCCACGAGGAGAGCTG
XM_005246376.1      CAGAGGTACAGTGCTGACCCCACCGTGTTTGCCCCAGAACGGAGCCCACGAGGAGAGCTG
NM_001042599.1      CAGAGGTACAGTGCTGACCCCACCGTGTTTGCCCCAGAACGGAGCCCACGAGGAGAGCTG
XM_005246377.1      CAGAGGTACAGTGCTGACCCCACCGTGTTTGCCCCAGAACGGAGCCCACGAGGAGAGCTG
                    ************************************************************

HsCD00000109        GATGAGGAAGGTTACATGACTCCTATGCGAGACAAACCCAAACAAGAATACCTGAATCCA
NM_005235.2         GATGAGGAAGGTTACATGACTCCTATGCGAGACAAACCCAAACAAGAATACCTGAATCCA
XM_005246375.1      GATGAGGAAGGTTACATGACTCCTATGCGAGACAAACCCAAACAAGAATACCTGAATCCA
XM_005246376.1      GATGAGGAAGGTTACATGACTCCTATGCGAGACAAACCCAAACAAGAATACCTGAATCCA
NM_001042599.1      GATGAGGAAGGTTACATGACTCCTATGCGAGACAAACCCAAACAAGAATACCTGAATCCA
XM_005246377.1      GATGAGGAAGGTTACATGACTCCTATGCGAGACAAACCCAAACAAGAATACCTGAATCCA
                    ************************************************************

HsCD00000109        GTGGAGGAGAACCCTTTTGTTTCTCGGAGAAAAAATGGAGACCTTCAAGCATTGGATAAT
NM_005235.2         GTGGAGGAGAACCCTTTTGTTTCTCGGAGAAAAAATGGAGACCTTCAAGCATTGGATAAT
XM_005246375.1      GTGGAGGAGAACCCTTTTGTTTCTCGGAGAAAAAATGGAGACCTTCAAGCATTGGATAAT
XM_005246376.1      GTGGAGGAGAACCCTTTTGTTTCTCGGAGAAAAAATGGAGACCTTCAAGCATTGGATAAT
NM_001042599.1      GTGGAGGAGAACCCTTTTGTTTCTCGGAGAAAAAATGGAGACCTTCAAGCATTGGATAAT
XM_005246377.1      GTGGAGGAGAACCCTTTTGTTTCTCGGAGAAAAAATGGAGACCTTCAAGCATTGGATAAT
                    ************************************************************

HsCD00000109        CCCGAATATCACAATGCATCCAATGGTCCACCCAAGGCCGAGGATGAGTATGTGAATGAG
NM_005235.2         CCCGAATATCACAATGCATCCAATGGTCCACCCAAGGCCGAGGATGAGTATGTGAATGAG
XM_005246375.1      CCCGAATATCACAATGCATCCAATGGTCCACCCAAGGCCGAGGATGAGTATGTGAATGAG
XM_005246376.1      CCCGAATATCACAATGCATCCAATGGTCCACCCAAGGCCGAGGATGAGTATGTGAATGAG
NM_001042599.1      CCCGAATATCACAATGCATCCAATGGTCCACCCAAGGCCGAGGATGAGTATGTGAATGAG
XM_005246377.1      CCCGAATATCACAATGCATCCAATGGTCCACCCAAGGCCGAGGATGAGTATGTGAATGAG
                    ************************************************************

HsCD00000109        CCACTGTACCTCAACACCTTTGCCAACACCTTGGGAAAAGCTGAGTACCTGAAGAACAAC
NM_005235.2         CCACTGTACCTCAACACCTTTGCCAACACCTTGGGAAAAGCTGAGTACCTGAAGAACAAC
XM_005246375.1      CCACTGTACCTCAACACCTTTGCCAACACCTTGGGAAAAGCTGAGTACCTGAAGAACAAC
XM_005246376.1      CCACTGTACCTCAACACCTTTGCCAACACCTTGGGAAAAGCTGAGTACCTGAAGAACAAC
NM_001042599.1      CCACTGTACCTCAACACCTTTGCCAACACCTTGGGAAAAGCTGAGTACCTGAAGAACAAC
XM_005246377.1      CCACTGTACCTCAACACCTTTGCCAACACCTTGGGAAAAGCTGAGTACCTGAAGAACAAC
                    ************************************************************

HsCD00000109        ATACTGTCAATGCCAGAGAAGGCCAAGAAAGCGTTTGACAACCCTGACTACTGGAACCAC
NM_005235.2         ATACTGTCAATGCCAGAGAAGGCCAAGAAAGCGTTTGACAACCCTGACTACTGGAACCAC
XM_005246375.1      ATACTGTCAATGCCAGAGAAGGCCAAGAAAGCGTTTGACAACCCTGACTACTGGAACCAC
XM_005246376.1      ATACTGTCAATGCCAGAGAAGGCCAAGAAAGCGTTTGACAACCCTGACTACTGGAACCAC
NM_001042599.1      ATACTGTCAATGCCAGAGAAGGCCAAGAAAGCGTTTGACAACCCTGACTACTGGAACCAC
XM_005246377.1      ATACTGTCAATGCCAGAGAAGGCCAAGAAAGCGTTTGACAACCCTGACTACTGGAACCAC
                    ************************************************************

HsCD00000109        AGCCTGCCACCTCGGAGCACCCTTCAGCACCCAGACTACCTGCAGGAGTACAGCACAAAA
NM_005235.2         AGCCTGCCACCTCGGAGCACCCTTCAGCACCCAGACTACCTGCAGGAGTACAGCACAAAA
XM_005246375.1      AGCCTGCCACCTCGGAGCACCCTTCAGCACCCAGACTACCTGCAGGAGTACAGCACAAAA
XM_005246376.1      AGCCTGCCACCTCGGAGCACCCTTCAGCACCCAGACTACCTGCAGGAGTACAGCACAAAA
NM_001042599.1      AGCCTGCCACCTCGGAGCACCCTTCAGCACCCAGACTACCTGCAGGAGTACAGCACAAAA
XM_005246377.1      AGCCTGCCACCTCGGAGCACCCTTCAGCACCCAGACTACCTGCAGGAGTACAGCACAAAA
                    ************************************************************

HsCD00000109        TATTTTTATAAACAGAATGGGCGGATCCGGCCTATTGTGGCAGAGAATCCTGAATACCTC
NM_005235.2         TATTTTTATAAACAGAATGGGCGGATCCGGCCTATTGTGGCAGAGAATCCTGAATACCTC
XM_005246375.1      TATTTTTATAAACAGAATGGGCGGATCCGGCCTATTGTGGCAGAGAATCCTGAATACCTC
XM_005246376.1      TATTTTTATAAACAGAATGGGCGGATCCGGCCTATTGTGGCAGAGAATCCTGAATACCTC
NM_001042599.1      TATTTTTATAAACAGAATGGGCGGATCCGGCCTATTGTGGCAGAGAATCCTGAATACCTC
XM_005246377.1      TATTTTTATAAACAGAATGGGCGGATCCGGCCTATTGTGGCAGAGAATCCTGAATACCTC
                    ************************************************************

HsCD00000109        TCTGAGTTCTCCCTGAAGCCAGGCACTGTGCTGCCGCCTCCACCTTACAGACACCGGAAT
NM_005235.2         TCTGAGTTCTCCCTGAAGCCAGGCACTGTGCTGCCGCCTCCACCTTACAGACACCGGAAT
XM_005246375.1      TCTGAGTTCTCCCTGAAGCCAGGCACTGTGCTGCCGCCTCCACCTTACAGACACCGGAAT
XM_005246376.1      TCTGAGTTCTCCCTGAAGCCAGGCACTGTGCTGCCGCCTCCACCTTACAGACACCGGAAT
NM_001042599.1      TCTGAGTTCTCCCTGAAGCCAGGCACTGTGCTGCCGCCTCCACCTTACAGACACCGGAAT
XM_005246377.1      TCTGAGTTCTCCCTGAAGCCAGGCACTGTGCTGCCGCCTCCACCTTACAGACACCGGAAT
                    ************************************************************

HsCD00000109        ACTGTGGTGTAA
NM_005235.2         ACTGTGGTGTAA
XM_005246375.1      ACTGTGGTGTAA
XM_005246376.1      ACTGTGGTGTAA
NM_001042599.1      ACTGTGGTGTAA
XM_005246377.1      ACTGTGGTGTAA
                    ************

Pathways

Panther : Alzheimer disease-presenilin pathway
Panther : Cadherin signaling pathway
Panther : EGF receptor signaling pathway
Reactome : Adaptive Immune System
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downregulation of ERBB4 signaling
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : GRB2 events in ERBB2 signaling
Reactome : Immune System
Reactome : Innate Immune System
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Nuclear signaling by ERBB4
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : SHC1 events in ERBB2 signaling
Reactome : SHC1 events in ERBB4 signaling
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
WikiPathway : ErbB signaling pathway

Clone

Cloning Information : 167267
HIP Master Clone ID : 140733
Original Clone ID : FLH167267.01X

Organism


TAX_ID : 9606
Species Specific ID: 2066

Genome

Chromosome : 2
Map Location : 2q33.3-q34
Ensembl : ENSG00000178568

Reagents

Labome : ERBB4-antibody