DNASU Plasmid Repository • 480.965.5697 | Email

IFNA17 (Homo sapiens) in pDONR201 (Gateway donor/master vector)


Explanation of Terms

Gene: Gene Symbol:  IFNA17
Gene Name:  interferon, alpha 17
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH054620.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Discrepancy :
No / Yes
Publications: None
Authors: HIP

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 570nts         Open reading frame : 1 to 570
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 619
Start on reference sequence 50

5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : IFNA17
Symbol Nomenclature : IFNA17
Designation : IFN-alpha-17|interferon alpha-17|interferon alpha-88|interferon alpha-I'|interferon alpha-T|interferon alpha-WA|leIF I
Full Nomenclature : interferon, alpha 17
GENEID : 3451
Locus Tag : RP11-380P16.10-001
GI : 60824496
GenBank Accession : AY893645
HGNC : 5422
MIM : 147583
Vega : OTTHUMG00000019667
Target GenBank: NM_021268


Reference Sequence Alignment


                  ******* *************** **** *********.******************** 

                  *****.****************************** ***********************

                  **** ********************.********** **************** **  **

                   * **. *****************.**************.********************



                  **.** ******************.************************:***** ****

                  **********.******************************.* .****.**********

                  *****************************************  **** **:****.**: 

                  ** .**.**. ***************:* .


NCI : Downstream signaling in naïve CD8+ T cells
Reactome : Cytokine Signaling in Immune system
Reactome : Factors involved in megakaryocyte development and platelet production
Reactome : Hemostasis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interferon Signaling
Reactome : Interferon alpha/beta signaling
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : Regulation of IFNA signaling
Reactome : TRAF6 mediated IRF7 activation
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Toll-like receptor signaling pathway


SMART domain : IFabd : Interferon alpha, beta and delta.
UniProt : P01571
HPRD : 00967


Cloning Information : 54620
HIP Master Clone ID : 12898
Original Clone ID : FLH054620.01L


TAX_ID : 9606
Species Specific ID: 3451


Chromosome : 9
Map Location : 9p22
Ensembl : ENSG00000234829


Labome : IFNA17-antibody