DNASU Plasmid Repository • 480.965.5697 | Email

GAL83 (Saccharomyces cerevisiae) in pBY011 (yeast expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  GAL83
Gene Name:  Glucose repression protein
Sequence             
Original Clone ID: FLH152530.01X
Keyword: None
Species: Saccharomyces cerevisiae
Type: cDNA
Vector Name: pBY011               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
ScCD00011347

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1254nts        
Open reading frame : 1 to 1254

ATGGCTGGCGACAACCCTGAAAACAAGGATGCTTCCATGTTAGATGTCAGTGACGCAGCT
AGCAACACTACGATTAATGGTAAACATAGCGCCGATTCAACTAATGAGGCTTCCCTGGCG
TACACTTTTTCTCAAATGAACGTAGATAATCCTAATGAATTAGAGCCTCAGCATCCTTTA
AGACATAAATCGAGTTTAATTTTTAACGACGATGATGACGATGAAATACCTCCATATTCA
AACCATGCGGAAAATGGTTCTGGGGAGACCTTTGATTCTGATGATGATATCGATGCTAGC
AGCTCGAGTAGTATCGACAGCAACGAAGGCGATATCCACGATGCAGATATGACAGGAAAT
ACCTTGCAAAAAATGGATTATCAACCATCTCAGCAGCCTGACTCACTTCAAAATCAAGGC
TTTCAACAGCAACAAGAACAGCAACAGGGCACTGTGGAAGGCAAGAAAGGAAGAGCTATG
ATGTTTCCAGTTGACATCACTTGGCAACAGGGGGGTAATAAAGTGTACGTTACTGGGTCT
TTTACGGGATGGAGAAAGATGATCGGGTTAGTACCAGTCCCTGGACAGCCTGGACTTATG
CATGTAAAATTACAGCTGCCTCCAGGTACTCATCGTTTCAGATTTATTGTTGACAATGAG
TTAAGATTCAGTGATTATTTACCTACCGCAACCGACCAAATGGGAAACTTCGTCAACTAT
ATGGAAGTGAGCGCACCGCCTGATTGGGGCAATGAACCTCAGCAGCATCTGGCTGAAAAA
AAAGCGAATCATGTAGATGATAGCAAATTGAGTAAGAGACCTATGAGCGCTCGCTCGAGA
ATCGCATTGGAGATAGAAAAGGAACCAGATGACATGGGCGATGGTTACACTCGTTTTCAC
GATGAGACCCCCGCTAAACCTAATTTAGAGTACACTCAAGATATACCTGCTGTGTTCACC
GACCCAAATGTAATGGAACAATATTATTTGACACTTGATCAGCAGCAAAATAATCACCAA
AATATGGCCTGGTTGACTCCTCCACAACTGCCACCTCATTTAGAAAACGTCATTTTGAAT
AGTTACTCAAACGCGCAAACTGATAATACGTCTGGCGCCCTTCCCATTCCGAACCATGTT
ATATTGAACCATCTGGCGACAAGCAGTATTAAGCATAATACATTATGTGTCGCATCCATT
GTTAGGTATAAACAAAAATACGTGACCCAAATACTGTATACACCATTGCAATAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
Start on reference sequence 1
End on reference sequence 1254
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p TCCAGCTGACCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)CATGGCAATTCCCGGGGAT

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  yeast    Marker:  URA
Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pBY011

pBY011 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Yeast expression vector with ARS1, CEN4, Gal1-10 promoter; amp resistance (URA3 for yeast); recombinational cloning.
Comments: This is a bacteria-yeast shuttle vector useful for expressing cDNAs in yeast that includes an auxotrophic marker for selection in yeast.
Size (bp): 8121
Parent Vector: Name: YCplac33
Description: Parent vector is a CEN4, URA3, ampR, ColE1 vector from R.D. Geitz described in Gene 74(2) 5270534 (1988). The Gal1-10 promoter and the Gateway-type attR recombination cassette (reference frame A, see information at the Invitrogen website) were inserted into the parent to create pBY011.
Empty Vector: None
Properties: Gateway, acceptor (destination), inducible expression, recombinational cloning, with tag/fusion/marker, yeast expression, yeast shuttle
Author Name: Bhullar
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin 3651 4333
negative selection marker ccdB ccdB negative selection marker gene LOST in recombined (with insert) form 4915 5124
primer M13 forward M13 forward sequencing primer 7183 7200
primer M13 reverse M13 reverse sequencing primer 4702 4722
promoter Gal1 Gal1-10 yeast promoter 6934 7145
promoter Ura3 promoter URA3 promoter 2349 2378
recombination site attR1 attR recombination site 1, lost or altered in recombined (with insert) form 6439 6455
recombination site attR2 attR recombination site 2, lost or altered in recombined (with insert) form 4749 4764
selectable marker AmpR ampicillin resistance gene 2894 3553
selectable marker CmR chloramphenicol resistance gene LOST in recombined (with insert) form 5566 6222
selectable marker Ura3 URA3 1460 2263
yeast centromere CEN yeast centromeric sequence 255 7396
yeast origin ARS1 ARS1 yeast origin of replication 0 0

 

  • Gene
  • Protein
  • Clone
  • Organism

Gene

Target GenBank: AAB64560

 

Clone

Cloning Information : 152530
HIP Master Clone ID : 88688
Original Clone ID : FLH152530.01X

Organism


Species Specific ID: YER027C