DNASU Plasmid Repository • 480.965.5697 | Email

MAP2K3 (Homo sapiens) in pDONR201 (Gateway donor/master vector)


Explanation of Terms

Gene: Gene Symbol:  MAP2K3
Gene Name:  mitogen-activated protein kinase kinase 3
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH053982.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Discrepancy :
No / Yes
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 957nts         Open reading frame : 1 to 957
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1294
Start on reference sequence 338

5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : MAP2K3
Symbol Nomenclature : MAP2K3
Designation : MAP kinase kinase 3|MAPK/ERK kinase 3|MAPKK 3|MEK 3|SAPK kinase 2|dual specificity mitogen-activated protein kinase kinase 3|stress-activated protein kinase kinase 2
Full Nomenclature : mitogen-activated protein kinase kinase 3
GENEID : 5606
GI : 60815162
GenBank Accession : AY893297
HGNC : 6843
MIM : 602315
Vega : OTTHUMG00000134322
Target GenBank: NM_002756


Reference Sequence Alignment


HsCD00001148        ------------------------------------------------------------
XM_005256723.1      ------------------------------------------------------------
NM_002756.4         ------------------------------------------------------------
XM_005256722.1      ------------------------------------------------------------

HsCD00001148        ---------------------------ATGTCCAAGCCACCCGCACCCAACCCCACACCC
XM_005256723.1      ---------------------------ATGTCCAAGCCACCCGCACCCAACCCCACACCC
NM_002756.4         ---------------------------ATGTCCAAGCCACCCGCACCCAACCCCACACCC
XM_005256722.1      ---------------------------ATGTCCAAGCCACCCGCACCCAACCCCACACCC


















NCI : CDC42 signaling events
NCI : CXCR3-mediated signaling events
NCI : Cellular roles of Anthrax toxin
NCI : IL12-mediated signaling events
NCI : RAC1 signaling pathway
NCI : Regulation of p38-alpha and p38-beta
NCI : RhoA signaling pathway
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling mediated by p38-gamma and p38-delta
NCI : TNF receptor signaling pathway
NCI : Trk receptor signaling mediated by the MAPK pathway
NCI : p38 MAPK signaling pathway
Panther : Apoptosis signaling pathway
Panther : EGF receptor signaling pathway
Panther : FGF signaling pathway
Panther : Insulin/IGF pathway-mitogen activated protein kinase kinase/MAP kinase cascade
Panther : Integrin signalling pathway
Panther : Oxidative stress response
Panther : Ras Pathway
Panther : Toll receptor signaling pathway
Reactome : Activated TLR4 signalling
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MAP kinase activation in TLR cascade
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : Oxidative Stress Induced Senescence
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : activated TAK1 mediates p38 MAPK activation
WikiPathway : Focal Adhesion
WikiPathway : Insulin Signaling
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : MAPK Cascade
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Physiological and Pathological Hypertrophy of the Heart
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Senescence and Autophagy
WikiPathway : Serotonin HTR1 Group and FOS Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TSH signaling pathway
WikiPathway : Toll-like receptor signaling pathway


Cloning Information : 53982
HIP Master Clone ID : 10243
Original Clone ID : FLH053982.01X


TAX_ID : 9606
Species Specific ID: 5606


Chromosome : 17
Map Location : 17q11.2
Ensembl : ENSG00000034152


Labome : MKK3-antibody