DNASU Plasmid Repository • 480.965.5697 | Email

FOS (Homo sapiens) in pDONR201 (Gateway donor/master vector)


Explanation of Terms

Gene: Gene Symbol:  FOS
Gene Name:  FBJ murine osteosarcoma viral oncogene homolog
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH056658.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Discrepancy :
No / No
Publications: None
Authors: HIP

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 1143nts         Open reading frame : 1 to 1143
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1298
Start on reference sequence 156
5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : FOS
Symbol Nomenclature : FOS
SYNONYM : AP-1; C-FOS; p55
Designation : FBJ murine osteosarcoma viral (v-fos) oncogene homolog (oncogene FOS)|G0/G1 switch regulatory protein 7|activator protein 1|cellular oncogene c-fos|proto-oncogene c-Fos
Full Nomenclature : FBJ murine osteosarcoma viral oncogene homolog
GENEID : 2353
GI : 60815229
GenBank Accession : AY893300
HGNC : 3796
MIM : 164810
Vega : OTTHUMG00000171774
Target GenBank: NM_005252


Reference Sequence Alignment






                  *********** ************************************************















HsCD00001155      TGA
NM_005252.3       TGA


NCI : AP-1 transcription factor network
NCI : ATF-2 transcription factor network
NCI : BCR signaling pathway
NCI : Calcineurin-regulated NFAT-dependent transcription in lymphocytes
NCI : Calcium signaling in the CD4+ TCR pathway
NCI : Downstream signaling in naïve CD8+ T cells
NCI : Endothelins
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : FGF signaling pathway
NCI : FOXA1 transcription factor network
NCI : FOXM1 transcription factor network
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : GMCSF-mediated signaling events
NCI : Glucocorticoid receptor regulatory network
NCI : HIF-1-alpha transcription factor network
NCI : IL12 signaling mediated by STAT4
NCI : IL12-mediated signaling events
NCI : IL2-mediated signaling events
NCI : IL6-mediated signaling events
NCI : LPA receptor mediated events
NCI : Nongenotropic Androgen signaling
NCI : Osteopontin-mediated events
NCI : PDGFR-alpha signaling pathway
NCI : PDGFR-beta signaling pathway
NCI : Presenilin action in Notch and Wnt signaling
NCI : Ras signaling in the CD4+ TCR pathway
NCI : Regulation of Telomerase
NCI : Regulation of nuclear SMAD2/3 signaling
NCI : RhoA signaling pathway
NCI : S1P2 pathway
NCI : Trk receptor signaling mediated by the MAPK pathway
Panther : Angiogenesis
Panther : Apoptosis signaling pathway
Panther : B cell activation
Panther : Huntington disease
Panther : Insulin/IGF pathway-mitogen activated protein kinase kinase/MAP kinase cascade
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
Panther : T cell activation
Reactome : Activated TLR4 signalling
Reactome : Activation of the AP-1 family of transcription factors
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : FCERI mediated MAPK activation
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MAP kinase activation in TLR cascade
Reactome : MAPK targets/ Nuclear events mediated by MAP kinases
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : Oxidative Stress Induced Senescence
Reactome : Senescence-Associated Secretory Phenotype (SASP)
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Estrogen signaling pathway
WikiPathway : IL-2 Signaling pathway
WikiPathway : IL-3 Signaling Pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : IL-5 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Kit receptor signaling pathway
WikiPathway : MAPK signaling pathway
WikiPathway : Myometrial Relaxation and Contraction Pathways
WikiPathway : Oxidative Stress
WikiPathway : Physiological and Pathological Hypertrophy of the Heart
WikiPathway : Prolactin Signaling Pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Selenium Metabolism and Selenoproteins
WikiPathway : Serotonin HTR1 Group and FOS Pathway
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor
WikiPathway : TCR Signaling Pathway
WikiPathway : TGF Beta Signaling Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TSH signaling pathway
WikiPathway : Toll-like receptor signaling pathway


SMART domain : BRLZ : basic region leucin zipper
UniProt : Q6FG41
UniProt : P01100
HPRD : 01275


Cloning Information : 56658
HIP Master Clone ID : 34946
Original Clone ID : FLH056658.01X


TAX_ID : 9606
Species Specific ID: 2353


Chromosome : 14
Map Location : 14q24.3
Ensembl : ENSG00000170345


Labome : c-Fos-antibody