DNASU Plasmid Repository • 480.965.5697 | Email

MAPK10 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MAPK10
Gene Name:  mitogen-activated protein kinase 10
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH057664.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00001161

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1269nts         Open reading frame : 1 to 1269
Reference Sequence Alignment

ATGAGCCTCCATTTCTTATACTACTGCAGTGAACCAACATTGGATGTGAAAATTGCCTTT
TGTCAGGGATTCGATAAACAAGTGGATGTGTCATATATTGCCAAACATTACAACATGAGC
AAAAGCAAAGTTGACAACCAGTTCTACAGTGTGGAAGTGGGAGACTCAACCTTCACAGTT
CTCAAGCGCTACCAGAATCTAAAGCCTATTGGCTCTGGGGCTCAGGGCATAGTTTGTGCC
GCGTATGATGCTGTCCTTGACAGAAATGTGGCCATTAAGAAGCTCAGCAGACCCTTTCAG
AACCAAACACATGCCAAGAGAGCGTACCGGGAGCTGGTCCTCATGAAGTGTGTGAACCAT
AAAAACATTATTAGTTTATTAAATGTCTTCACACCCCAGAAAACGCTGGAGGAGTTCCAA
GATGTTTACTTAGTAATGGAACTGATGGATGCCAACTTATGTCAAGTGATTCAGATGGAA
TTAGACCATGAGCGAATGTCTTACCTGCTGTACCAAATGTTGTGTGGCATTAAGCACCTC
CATTCTGCTGGAATTATTCACAGGGATTTAAAACCAAGTAACATTGTAGTCAAGTCTGAT
TGCACATTGAAAATCCTGGACTTTGGACTGGCCAGGACAGCAGGCACAAGCTTCATGATG
ACTCCATATGTGGTGACACGTTATTACAGAGCCCCTGAGGTCATCCTGGGGATGGGCTAC
AAGGAGAACGTGGATATATGGTCTGTGGGATGCATTATGGGAGAAATGGTTCGCCACAAA
ATCCTCTTTCCAGGAAGGGACTATATTGACCAGTGGAATAAGGTAATTGAACAACTAGGA
ACACCATGTCCAGAATTCATGAAGAAATTGCAACCCACAGTAAGAAACTATGTGGAGAAT
CGGCCCAAGTATGCGGGACTCACCTTCCCCAAACTCTTCCCAGATTCCCTCTTCCCAGCG
GACTCCGAGCACAATAAACTCAAAGCCAGTCAAGCCAGGGACTTGTTGTCAAAGATGCTA
GTGATTGACCCAGCAAAAAGAATATCAGTGGACGACGCCTTACAGCATCCCTACATCAAC
GTCTGGTATGACCCAGCCGAAGTGGAGGCGCCTCCACCTCAGATATATGACAAGCAGTTG
GATGAAAGAGAACACACAATTGAAGAATGGAAAGAACTTATCTACAAGGAAGTAATGAAT
TCAGAAGAAAAGACTAAAAATGGTGTAGTAAAAGGACAGCCTTCTCCTTCAGCACAGGTG
CAGCAGGAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1492
Start on reference sequence 224
Mutations:
None
Discrepancy:
c990t
                                

5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Reagents

Gene

Target GenBank: NM_002753

 

Reference Sequence Alignment

  

HsCD00001161        ATGAGCCTCCATTTCTTATACTACTGCAGTGAACCAACATTGGATGTGAAAATTGCCTTT
XM_005263129.1      ATGAGCCTCCATTTCTTATACTACTGCAGTGAACCAACATTGGATGTGAAAATTGCCTTT
NM_139046.2         ------------------------------------------------------------
XM_005263130.1      ATGAGCCTCCATTTCTTATACTACTGCAGTGAACCAACATTGGATGTGAAAATTGCCTTT
NM_002750.3         ------------------------------------------------------------
NM_138980.2         ------------------------------------------------------------
NM_001278547.1      ------------------------------------------------------------
NM_139049.2         ------------------------------------------------------------
NM_138982.2         ATGAGCCTCCATTTCTTATACTACTGCAGTGAACCAACATTGGATGTGAAAATTGCCTTT
NM_002753.3         ATGAGCCTCCATTTCTTATACTACTGCAGTGAACCAACATTGGATGTGAAAATTGCCTTT
                                                                                

HsCD00001161        TGTCAGGGATTCGATAAACAAGTGGATGTGTCATATATTGCCAAACATTACAACATGAGC
XM_005263129.1      TGTCAGGGATTCGATAAACAAGTGGATGTGTCATATATTGCCAAACATTACAACATGAGC
NM_139046.2         ------------------------------------------------------ATGAGC
XM_005263130.1      TGTCAGGGATTCGATAAACAAGTGGATGTGTCATATATTGCCAAACATTACAACATGAGC
NM_002750.3         ------------------------------------------------------ATGAGC
NM_138980.2         ------------------------------------------------------ATGAGC
NM_001278547.1      ------------------------------------------------------ATGAGC
NM_139049.2         ------------------------------------------------------ATGAGC
NM_138982.2         TGTCAGGGATTCGATAAACAAGTGGATGTGTCATATATTGCCAAACATTACAACATGAGC
NM_002753.3         TGTCAGGGATTCGATAAACAAGTGGATGTGTCATATATTGCCAAACATTACAACATGAGC
                                                                          ******

HsCD00001161        AAAAGCAAAGTTGACAACCAGTTCTACAGTGTGGAAGTGGGAGACTCAACCTTCACAGTT
XM_005263129.1      AAAAGCAAAGTTGACAACCAGTTCTACAGTGTGGAAGTGGGAGACTCAACCTTCACAGTT
NM_139046.2         AGAAGCAAGCGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTC
XM_005263130.1      AAAAGCAAAGTTGACAACCAGTTCTACAGTGTGGAAGTGGGAGACTCAACCTTCACAGTT
NM_002750.3         AGAAGCAAGCGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTC
NM_138980.2         AAAAGCAAAGTTGACAACCAGTTCTACAGTGTGGAAGTGGGAGACTCAACCTTCACAGTT
NM_001278547.1      AGAAGCAAGCGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTC
NM_139049.2         AGAAGCAAGCGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTC
NM_138982.2         AAAAGCAAAGTTGACAACCAGTTCTACAGTGTGGAAGTGGGAGACTCAACCTTCACAGTT
NM_002753.3         AAAAGCAAAGTTGACAACCAGTTCTACAGTGTGGAAGTGGGAGACTCAACCTTCACAGTT
                    *.******.  *******.* ** ** *****.**..* ***** **:**.******** 

HsCD00001161        CTCAAGCGCTACCAGAATCTAAAGCCTATTGGCTCTGGGGCTCAGGGCATAGTTTGTGCC
XM_005263129.1      CTCAAGCGCTACCAGAATCTAAAGCCTATTGGCTCTGGGGCTCAGGGCATAGTTTGTGCC
NM_139046.2         CTGAAACGATATCAGAATTTAAAACCTATAGGCTCAGGAGCTCAAGGAATAGTATGCGCA
XM_005263130.1      CTCAAGCGCTACCAGAATCTAAAGCCTATTGGCTCTGGGGCTCAGGGCATAGTTTGTGCC
NM_002750.3         CTGAAACGATATCAGAATTTAAAACCTATAGGCTCAGGAGCTCAAGGAATAGTATGCGCA
NM_138980.2         CTCAAGCGCTACCAGAATCTAAAGCCTATTGGCTCTGGGGCTCAGGGCATAGTTTGTGCC
NM_001278547.1      CTGAAACGATATCAGAATTTAAAACCTATAGGCTCAGGAGCTCAAGGAATAGTATGCGCA
NM_139049.2         CTGAAACGATATCAGAATTTAAAACCTATAGGCTCAGGAGCTCAAGGAATAGTATGCGCA
NM_138982.2         CTCAAGCGCTACCAGAATCTAAAGCCTATTGGCTCTGGGGCTCAGGGCATAGTTTGTGCC
NM_002753.3         CTCAAGCGCTACCAGAATCTAAAGCCTATTGGCTCTGGGGCTCAGGGCATAGTTTGTGCC
                    ** **.**.** ****** ****.*****:*****:**.*****.**.*****:** **.

HsCD00001161        GCGTATGATGCTGTCCTTGACAGAAATGTGGCCATTAAGAAGCTCAGCAGACCCTTTCAG
XM_005263129.1      GCGTATGATGCTGTCCTTGACAGAAATGTGGCCATTAAGAAGCTCAGCAGACCCTTTCAG
NM_139046.2         GCTTATGATGCCATTCTTGAAAGAAATGTTGCAATCAAGAAGCTAAGCCGACCATTTCAG
XM_005263130.1      GCGTATGATGCTGTCCTTGACAGAAATGTGGCCATTAAGAAGCTCAGCAGACCCTTTCAG
NM_002750.3         GCTTATGATGCCATTCTTGAAAGAAATGTTGCAATCAAGAAGCTAAGCCGACCATTTCAG
NM_138980.2         GCGTATGATGCTGTCCTTGACAGAAATGTGGCCATTAAGAAGCTCAGCAGACCCTTTCAG
NM_001278547.1      GCTTATGATGCCATTCTTGAAAGAAATGTTGCAATCAAGAAGCTAAGCCGACCATTTCAG
NM_139049.2         GCTTATGATGCCATTCTTGAAAGAAATGTTGCAATCAAGAAGCTAAGCCGACCATTTCAG
NM_138982.2         GCGTATGATGCTGTCCTTGACAGAAATGTGGCCATTAAGAAGCTCAGCAGACCCTTTCAG
NM_002753.3         GCGTATGATGCTGTCCTTGACAGAAATGTGGCCATTAAGAAGCTCAGCAGACCCTTTCAG
                    ** ******** .* *****.******** **.** ********.***.****.******

HsCD00001161        AACCAAACACATGCCAAGAGAGCGTACCGGGAGCTGGTCCTCATGAAGTGTGTGAACCAT
XM_005263129.1      AACCAAACACATGCCAAGAGAGCGTACCGGGAGCTGGTCCTCATGAAGTGTGTGAACCAT
NM_139046.2         AATCAGACTCATGCCAAGCGGGCCTACAGAGAGCTAGTTCTTATGAAATGTGTTAATCAC
XM_005263130.1      AACCAAACACATGCCAAGAGAGCGTACCGGGAGCTGGTCCTCATGAAGTGTGTGAACCAT
NM_002750.3         AATCAGACTCATGCCAAGCGGGCCTACAGAGAGCTAGTTCTTATGAAATGTGTTAATCAC
NM_138980.2         AACCAAACACATGCCAAGAGAGCGTACCGGGAGCTGGTCCTCATGAAGTGTGTGAACCAT
NM_001278547.1      AATCAGACTCATGCCAAGCGGGCCTACAGAGAGCTAGTTCTTATGAAATGTGTTAATCAC
NM_139049.2         AATCAGACTCATGCCAAGCGGGCCTACAGAGAGCTAGTTCTTATGAAATGTGTTAATCAC
NM_138982.2         AACCAAACACATGCCAAGAGAGCGTACCGGGAGCTGGTCCTCATGAAGTGTGTGAACCAT
NM_002753.3         AACCAAACACATGCCAAGAGAGCGTACCGGGAGCTGGTCCTCATGAAGTGTGTGAACCAT
                    ** **.**:*********.*.** ***.*.*****.** ** *****.***** ** ** 

HsCD00001161        AAAAACATTATTAGTTTATTAAATGTCTTCACACCCCAGAAAACGCTGGAGGAGTTCCAA
XM_005263129.1      AAAAACATTATTAGTTTATTAAATGTCTTCACACCCCAGAAAACGCTGGAGGAGTTCCAA
NM_139046.2         AAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAA
XM_005263130.1      AAAAACATTATTAGTTTATTAAATGTCTTCACACCCCAGAAAACGCTGGAGGAGTTCCAA
NM_002750.3         AAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAA
NM_138980.2         AAAAACATTATTAGTTTATTAAATGTCTTCACACCCCAGAAAACGCTGGAGGAGTTCCAA
NM_001278547.1      AAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAA
NM_139049.2         AAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAA
NM_138982.2         AAAAACATTATTAGTTTATTAAATGTCTTCACACCCCAGAAAACGCTGGAGGAGTTCCAA
NM_002753.3         AAAAACATTATTAGTTTATTAAATGTCTTCACACCCCAGAAAACGCTGGAGGAGTTCCAA
                    ***** **:***.*  *:**.***** ********.******:* **.**.**.** ***

HsCD00001161        GATGTTTACTTAGTAATGGAACTGATGGATGCCAACTTATGTCAAGTGATTCAGATGGAA
XM_005263129.1      GATGTTTACTTAGTAATGGAACTGATGGATGCCAACTTATGTCAAGTGATTCAGATGGAA
NM_139046.2         GATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAG
XM_005263130.1      GATGTTTACTTAGTAATGGAACTGATGGATGCCAACTTATGTCAAGTGATTCAGATGGAA
NM_002750.3         GATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAG
NM_138980.2         GATGTTTACTTAGTAATGGAACTGATGGATGCCAACTTATGTCAAGTGATTCAGATGGAA
NM_001278547.1      GATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAG
NM_139049.2         GATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAG
NM_138982.2         GATGTTTACTTAGTAATGGAACTGATGGATGCCAACTTATGTCAAGTGATTCAGATGGAA
NM_002753.3         GATGTTTACTTAGTAATGGAACTGATGGATGCCAACTTATGTCAAGTGATTCAGATGGAA
                    *********:****.*****.** ********.**  *:** *****************.

HsCD00001161        TTAGACCATGAGCGAATGTCTTACCTGCTGTACCAAATGTTGTGTGGCATTAAGCACCTC
XM_005263129.1      TTAGACCATGAGCGAATGTCTTACCTGCTGTACCAAATGTTGTGTGGCATTAAGCACCTC
NM_139046.2         CTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTT
XM_005263130.1      TTAGACCATGAGCGAATGTCTTACCTGCTGTACCAAATGTTGTGTGGCATTAAGCACCTC
NM_002750.3         CTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTT
NM_138980.2         TTAGACCATGAGCGAATGTCTTACCTGCTGTACCAAATGTTGTGTGGCATTAAGCACCTC
NM_001278547.1      CTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTT
NM_139049.2         CTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTT
NM_138982.2         TTAGACCATGAGCGAATGTCTTACCTGCTGTACCAAATGTTGTGTGGCATTAAGCACCTC
NM_002753.3         TTAGACCATGAGCGAATGTCTTACCTGCTGTACCAAATGTTGTGTGGCATTAAGCACCTC
                     **** *****..******* ***** ** ** **.*** *******.** ******** 

HsCD00001161        CATTCTGCTGGAATTATTCACAGGGATTTAAAACCAAGTAACATTGTAGTCAAGTCTGAT
XM_005263129.1      CATTCTGCTGGAATTATTCACAGGGATTTAAAACCAAGTAACATTGTAGTCAAGTCTGAT
NM_139046.2         CATTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGAT
XM_005263130.1      CATTCTGCTGGAATTATTCACAGGGATTTAAAACCAAGTAACATTGTAGTCAAGTCTGAT
NM_002750.3         CATTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGAT
NM_138980.2         CATTCTGCTGGAATTATTCACAGGGATTTAAAACCAAGTAACATTGTAGTCAAGTCTGAT
NM_001278547.1      CATTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGAT
NM_139049.2         CATTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGAT
NM_138982.2         CATTCTGCTGGAATTATTCACAGGGATTTAAAACCAAGTAACATTGTAGTCAAGTCTGAT
NM_002753.3         CATTCTGCTGGAATTATTCACAGGGATTTAAAACCAAGTAACATTGTAGTCAAGTCTGAT
                    ******************** .**** *****.**.***** **:*****.**.******

HsCD00001161        TGCACATTGAAAATCCTGGACTTTGGACTGGCCAGGACAGCAGGCACAAGCTTCATGATG
XM_005263129.1      TGCACATTGAAAATCCTGGACTTTGGACTGGCCAGGACAGCAGGCACAAGCTTCATGATG
NM_139046.2         TGCACTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATG
XM_005263130.1      TGCACATTGAAAATCCTGGACTTTGGACTGGCCAGGACAGCAGGCACAAGCTTCATGATG
NM_002750.3         TGCACTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATG
NM_138980.2         TGCACATTGAAAATCCTGGACTTTGGACTGGCCAGGACAGCAGGCACAAGCTTCATGATG
NM_001278547.1      TGCACTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATG
NM_139049.2         TGCACTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATG
NM_138982.2         TGCACATTGAAAATCCTGGACTTTGGACTGGCCAGGACAGCAGGCACAAGCTTCATGATG
NM_002753.3         TGCACATTGAAAATCCTGGACTTTGGACTGGCCAGGACAGCAGGCACAAGCTTCATGATG
                    *****:*****.** ** ***** **:***********:*****.**.** ** ******

HsCD00001161        ACTCCATATGTGGTGACACGTTATTACAGAGCCCCTGAGGTCATCCTGGGGATGGGCTAC
XM_005263129.1      ACTCCATATGTGGTGACACGTTATTACAGAGCCCCTGAGGTCATCCTGGGGATGGGCTAC
NM_139046.2         ACGCCTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTAC
XM_005263130.1      ACTCCATATGTGGTGACACGTTATTACAGAGCCCCTGAGGTCATCCTGGGGATGGGCTAC
NM_002750.3         ACGCCTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTAC
NM_138980.2         ACTCCATATGTGGTGACACGTTATTACAGAGCCCCTGAGGTCATCCTGGGGATGGGCTAC
NM_001278547.1      ACGCCTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTAC
NM_139049.2         ACGCCTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTAC
NM_138982.2         ACTCCATATGTGGTGACACGTTATTACAGAGCCCCTGAGGTCATCCTGGGGATGGGCTAC
NM_002753.3         ACTCCATATGTGGTGACACGTTATTACAGAGCCCCTGAGGTCATCCTGGGGATGGGCTAC
                    ** **:*****.*****:** ** ********.** *********** ** *********

HsCD00001161        AAGGAGAACGTGGATATATGGTCTGTGGGATGCATTATGGGAGAAATGGTTCGCCACAAA
XM_005263129.1      AAGGAGAACGTGGATATATGGTCTGTGGGATGCATTATGGGAGAAATGGTTCGCCACAAA
NM_139046.2         AAGGAAAACGTTGACATTTGGTCAGTTGGGTGCATCATGGGAGAAATGATCAAAGGTGGT
XM_005263130.1      AAGGAGAACGTGGATATATGGTCTGTGGGATGCATTATGGGAGAAATGGTTCGCCACAAA
NM_002750.3         AAGGAAAACGTGGATTTATGGTCTGTGGGGTGCATTATGGGAGAAATGGTTTGCCACAAA
NM_138980.2         AAGGAGAACGTGGATATATGGTCTGTGGGATGCATTATGGGAGAAATGGTTCGCCACAAA
NM_001278547.1      AAGGAAAACGTTGACATTTGGTCAGTTGGGTGCATCATGGGAGAAATGATCAAAGGTGGT
NM_139049.2         AAGGAAAACGTGGATTTATGGTCTGTGGGGTGCATTATGGGAGAAATGGTTTGCCACAAA
NM_138982.2         AAGGAGAACGTGGATATATGGTCTGTGGGATGCATTATGGGAGAAATGGTTCGCCACAAA
NM_002753.3         AAGGAGAACGTGGATATATGGTCTGTGGGATGCATTATGGGAGAAATGGTTCGCCACAAA
                    *****.***** ** :*:*****:** **.***** ************.*  .. . ..:

HsCD00001161        ATCCTCTTTCCAGGAAGGGACTATATTGACCAGTGGAATAAGGTAATTGAACAACTAGGA
XM_005263129.1      ATCCTCTTTCCAGGAAGGGACTATATTGACCAGTGGAATAAGGTAATTGAACAACTAGGA
NM_139046.2         GTTTTGTTCCCAGGTACAGATCATATTGATCAGTGGAATAAAGTTATTGAACAGCTTGGA
XM_005263130.1      ATCCTCTTTCCAGGAAGGGACTATATTGACCAGTGGAATAAGGTAATTGAACAACTAGGA
NM_002750.3         ATCCTCTTTCCAGGAAGGGACTATATTGATCAGTGGAATAAAGTTATTGAACAGCTTGGA
NM_138980.2         ATCCTCTTTCCAGGAAGGGACTATATTGACCAGTGGAATAAGGTAATTGAACAACTAGGA
NM_001278547.1      GTTTTGTTCCCAGGTACAGATCATATTGATCAGTGGAATAAAGTTATTGAACAGCTTGGA
NM_139049.2         ATCCTCTTTCCAGGAAGGGACTATATTGATCAGTGGAATAAAGTTATTGAACAGCTTGGA
NM_138982.2         ATCCTCTTTCCAGGAAGGGACTATATTGACCAGTGGAATAAGGTAATTGAACAACTAGGA
NM_002753.3         ATCCTCTTTCCAGGAAGGGACTATATTGACCAGTGGAATAAGGTAATTGAACAACTAGGA
                    .*  * ** *****:* .**  ******* ***********.**:********.**:***

HsCD00001161        ACACCATGTCCAGAATTCATGAAGAAATTGCAACCCACAGTAAGAAACTATGTGGAGAAT
XM_005263129.1      ACACCATGTCCAGAATTCATGAAGAAATTGCAACCCACAGTAAGAAACTATGTGGAGAAT
NM_139046.2         ACACCATGTCCTGAATTCATGAAGAAACTGCAACCAACAGTAAGGACTTACGTTGAAAAC
XM_005263130.1      ACACCATGTCCAGAATTCATGAAGAAATTGCAACCCACAGTAAGAAACTATGTGGAGAAT
NM_002750.3         ACACCATGTCCTGAATTCATGAAGAAACTGCAACCAACAGTAAGGACTTACGTTGAAAAC
NM_138980.2         ACACCATGTCCAGAATTCATGAAGAAATTGCAACCCACAGTAAGAAACTATGTGGAGAAT
NM_001278547.1      ACACCATGTCCTGAATTCATGAAGAAACTGCAACCAACAGTAAGGACTTACGTTGAAAAC
NM_139049.2         ACACCATGTCCTGAATTCATGAAGAAACTGCAACCAACAGTAAGGACTTACGTTGAAAAC
NM_138982.2         ACACCATGTCCAGAATTCATGAAGAAATTGCAACCCACAGTAAGAAACTATGTGGAGAAT
NM_002753.3         ACACCATGTCCAGAATTCATGAAGAAATTGCAACCCACAGTAAGAAACTATGTGGAGAAT
                    ***********:*************** *******.********.*. ** ** **.** 

HsCD00001161        CGGCCCAAGTATGCGGGACTCACCTTCCCCAAACTCTTCCCAGATTCCCTCTTCCCAGCG
XM_005263129.1      CGGCCCAAGTATGCGGGACTCACCTTCCCCAAACTCTTCCCAGATTCCCTCTTCCCAGCG
NM_139046.2         AGACCTAAATATGCTGGATATAGCTTTGAGAAACTCTTCCCTGATGTCCTTTTCCCAGCT
XM_005263130.1      CGGCCCAAGTATGCGGGACTCACCTTCCCCAAACTCTTCCCAGATTCCCTCTTCCCAGCG
NM_002750.3         AGACCTAAATATGCTGGATATAGCTTTGAGAAACTCTTCCCTGATGTCCTTTTCCCAGCT
NM_138980.2         CGGCCCAAGTATGCGGGACTCACCTTCCCCAAACTCTTCCCAGATTCCCTCTTCCCAGCG
NM_001278547.1      AGACCTAAATATGCTGGATATAGCTTTGAGAAACTCTTCCCTGATGTCCTTTTCCCAGCT
NM_139049.2         AGACCTAAATATGCTGGATATAGCTTTGAGAAACTCTTCCCTGATGTCCTTTTCCCAGCT
NM_138982.2         CGGCCCAAGTATGCGGGACTCACCTTCCCCAAACTCTTCCCAGATTCCCTCTTCCCAGCG
NM_002753.3         CGGCCCAAGTATGCGGGACTCACCTTCCCCAAACTCTTCCCAGATTCCCTCTTCCCAGCG
                    .*.** **.***** *** : * ***  . ***********:***  *** ******** 

HsCD00001161        GACTCCGAGCACAATAAACTCAAAGCCAGTCAAGCCAGGGACTTGTTGTCAAAGATGCTA
XM_005263129.1      GACTCCGAGCACAATAAACTCAAAGCCAGCCAAGCCAGGGACTTGTTGTCAAAGATGCTA
NM_139046.2         GACTCAGAACACAACAAACTTAAAGCCAGTCAGGCAAGGGATTTGTTATCCAAAATGCTG
XM_005263130.1      GACTCCGAGCACAATAAACTCAAAGCCAGCCAAGCCAGGGACTTGTTGTCAAAGATGCTA
NM_002750.3         GACTCAGAACACAACAAACTTAAAGCCAGTCAGGCAAGGGATTTGTTATCCAAAATGCTG
NM_138980.2         GACTCCGAGCACAATAAACTCAAAGCCAGCCAAGCCAGGGACTTGTTGTCAAAGATGCTA
NM_001278547.1      GACTCAGAACACAACAAACTTAAAGCCAGTCAGGCAAGGGATTTGTTATCCAAAATGCTG
NM_139049.2         GACTCAGAACACAACAAACTTAAAGCCAGTCAGGCAAGGGATTTGTTATCCAAAATGCTG
NM_138982.2         GACTCCGAGCACAATAAACTCAAAGCCAGCCAAGCCAGGGACTTGTTGTCAAAGATGCTA
NM_002753.3         GACTCCGAGCACAATAAACTCAAAGCCAGCCAAGCCAGGGACTTGTTGTCAAAGATGCTA
                    *****.**.***** ***** ******** **.**.***** *****.**.**.*****.

HsCD00001161        GTGATTGACCCAGCAAAAAGAATATCAGTGGACGACGCCTTACAGCATCCCTACATCAAC
XM_005263129.1      GTGATTGACCCAGCAAAAAGAATATCAGTGGACGACGCCTTACAGCATCCCTACATCAAC
NM_139046.2         GTAATAGATGCATCTAAAAGGATCTCTGTAGATGAAGCTCTCCAACACCCGTACATCAAT
XM_005263130.1      GTGATTGACCCAGCAAAAAGAATATCAGTGGACGACGCCTTACAGCATCCCTACATCAAC
NM_002750.3         GTAATAGATGCATCTAAAAGGATCTCTGTAGATGAAGCTCTCCAACACCCGTACATCAAT
NM_138980.2         GTGATTGACCCAGCAAAAAGAATATCAGTGGACGACGCCTTACAGCATCCCTACATCAAC
NM_001278547.1      GTAATAGATGCATCTAAAAGGATCTCTGTAGATGAAGCTCTCCAACACCCGTACATCAAT
NM_139049.2         GTAATAGATGCATCTAAAAGGATCTCTGTAGATGAAGCTCTCCAACACCCGTACATCAAT
NM_138982.2         GTGATTGACCCAGCAAAAAGAATATCAGTGGACGACGCCTTACAGCATCCCTACATCAAC
NM_002753.3         GTGATTGACCCAGCAAAAAGAATATCAGTGGACGACGCCTTACAGCATCCCTACATCAAC
                    **.**:**  ** *:*****.**.**:**.** **.**  *.**.** ** ******** 

HsCD00001161        GTCTGGTATGACCCAGCCGAAGTGGAGGCGCCTCCACCTCAGATATATGACAAGCAGTTG
XM_005263129.1      GTCTGGTATGACCCAGCCGAAGTGGAGGCGCCTCCACCTCAGATATATGACAAGCAGTTG
NM_139046.2         GTCTGGTATGATCCTTCTGAAGCAGAAGCTCCACCACCAAAGATCCCTGACAAGCAGTTA
XM_005263130.1      GTCTGGTATGACCCAGCCGAAGTGGAGGCGCCTCCACCTCAGATATATGACAAGCAGTTG
NM_002750.3         GTCTGGTATGATCCTTCTGAAGCAGAAGCTCCACCACCAAAGATCCCTGACAAGCAGTTA
NM_138980.2         GTCTGGTATGACCCAGCCGAAGTGGAGGCGCCTCCACCTCAGATATATGACAAGCAGTTG
NM_001278547.1      GTCTGGTATGATCCTTCTGAAGCAGAAGCTCCACCACCAAAGATCCCTGACAAGCAGTTA
NM_139049.2         GTCTGGTATGATCCTTCTGAAGCAGAAGCTCCACCACCAAAGATCCCTGACAAGCAGTTA
NM_138982.2         GTCTGGTATGACCCAGCCGAAGTGGAGGCGCCTCCACCTCAGATATATGACAAGCAGTTG
NM_002753.3         GTCTGGTATGACCCAGCCGAAGTGGAGGCGCCTCCACCTCAGATATATGACAAGCAGTTG
                    *********** **: * **** .**.** **:*****:.****. .************.

HsCD00001161        GATGAAAGAGAACACACAATTGAAGAATGGAAAGAACTTATCTACAAGGAAGTAATGAAT
XM_005263129.1      GATGAAAGAGAACACACAATTGAAGAATGGAAAGAACTTATCTACAAGGAAGTAATGAAT
NM_139046.2         GATGAAAGGGAACACACAATAGAAGAGTGGAAAGAATTGATATATAAGGAAGTTATGGAC
XM_005263130.1      GATGAAAGAGAACACACAATTGAAGAATGGAAAGAACTTATCTACAAGGAAGTAATGAAT
NM_002750.3         GATGAAAGGGAACACACAATAGAAGAGTGGAAAGAATTGATATATAAGGAAGTTATGGAC
NM_138980.2         GATGAAAGAGAACACACAATTGAAGAATGGAAAGAACTTATCTACAAGGAAGTAATGAAT
NM_001278547.1      GATGAAAGGGAACACACAATAGAAGAGTGGAAAGAATTGATATATAAGGAAGTTATGGAC
NM_139049.2         GATGAAAGGGAACACACAATAGAAGAGTGGAAAGAATTGATATATAAGGAAGTTATGGAC
NM_138982.2         GATGAAAGAGAACACACAATTGAAGAATGGAAAGAACTTATCTACAAGGAAGTAATGAAT
NM_002753.3         GATGAAAGAGAACACACAATTGAAGAATGGAAAGAACTTATCTACAAGGAAGTAATGAAT
                    ********.***********:*****.********* * **.** ********:***.* 

HsCD00001161        TCAGAAGAAAAGACTAAAAATGGTGTAGTAAAAGGACAGCCTTCTCCTTCAGCACAGGTG
XM_005263129.1      TCAGAAGAAAAGACTAAAAATGGTGTAGTAAAAGGACAGCCTTCTCCTTCAGGTGCAGCA
NM_139046.2         TTGGAGGAGAGAACCAAGAATGGAGTTATACGGGGGCAGCCCTCTCCTTTAGCACAGGTG
XM_005263130.1      TCAGAAGAAAAGACTAAAAATGGTGTAGTAAAAGGACAGCCTTCTCCTTCAGGTGCAGCA
NM_002750.3         TTGGAGGAGAGAACCAAGAATGGAGTTATACGGGGGCAGCCCTCTCCTTTAGCACAGGTG
NM_138980.2         TCAGAAGAAAAGACTAAAAATGGTGTAGTAAAAGGACAGCCTTCTCCTTCAGGTGCAGCA
NM_001278547.1      TTGGAGGAGAGAACCAAGAATGGAGTTATACGGGGGCAGCCCTCTCCTTTAGGTGCAGCA
NM_139049.2         TTGGAGGAGAGAACCAAGAATGGAGTTATACGGGGGCAGCCCTCTCCTTTAGGTGCAGCA
NM_138982.2         TCAGAAGAAAAGACTAAAAATGGTGTAGTAAAAGGACAGCCTTCTCCTTCAGGTGCAGCA
NM_002753.3         TCAGAAGAAAAGACTAAAAATGGTGTAGTAAAAGGACAGCCTTCTCCTTCAGCACAGGTG
                    * .**.**.*..** **.*****:**:.**...**.***** ******* ** : ..* .

HsCD00001161        CAGCAGGAC---------------------------------------------------
XM_005263129.1      GTGAACAGCAGTGAGAG---TCTCCCTCCATCCTCGTCTGTCAATGACATCTCCTCCATG
NM_139046.2         CAGCAGTGA---------------------------------------------------
XM_005263130.1      GTGAACAGCAGTGAGAG---TCTCCCTCCATCCTCGTCTGTCAATGACATCTCCTCCATG
NM_002750.3         CAGCAGTGA---------------------------------------------------
NM_138980.2         GTGAACAGCAGTGAGAG---TCTCCCTCCATCCTCGTCTGTCAATGACATCTCCTCCATG
NM_001278547.1      GTGATCAATGGCTCTCAGCATCCATCATCATCGTCGTCTGTCAATGATGTGTCTTCAATG
NM_139049.2         GTGATCAATGGCTCTCAGCATCCATCATCATCGTCGTCTGTCAATGATGTGTCTTCAATG
NM_138982.2         GTGAACAGCAGTGAGAG---TCTCCCTCCATCCTCGTCTGTCAATGACATCTCCTCCATG
NM_002753.3         CAGCAGTGA---------------------------------------------------
                     :*.:  .                                                    

HsCD00001161        ------------------------------------------------------------
XM_005263129.1      TCCACCGACCAGACCCTGGCATCTGACACTGACAGCAGCCTGGAAGCCTCGGCAGGACCC
NM_139046.2         ------------------------------------------------------------
XM_005263130.1      TCCACCGACCAGACCCTGGCATCTGACACTGACAGCAGCCTGGAAGCCTCGGCAGGACCC
NM_002750.3         ------------------------------------------------------------
NM_138980.2         TCCACCGACCAGACCCTGGCATCTGACACTGACAGCAGCCTGGAAGCCTCGGCAGGACCC
NM_001278547.1      TCAACAGATCCGACTTTGGCCTCTGATACAGACAGCAGTCTAGAAGCAGCAGCTGGGCCT
NM_139049.2         TCAACAGATCCGACTTTGGCCTCTGATACAGACAGCAGTCTAGAAGCAGCAGCTGGGCCT
NM_138982.2         TCCACCGACCAGACCCTGGCATCTGACACTGACAGCAGCCTGGAAGCCTCGGCAGGACCC
NM_002753.3         ------------------------------------------------------------
                                                                                

HsCD00001161        ------------------
XM_005263129.1      CTGGGTTGTTGCAGGTGA
NM_139046.2         ------------------
XM_005263130.1      CTGGGTTGTTGCAGGTGA
NM_002750.3         ------------------
NM_138980.2         CTGGGTTGTTGCAGGTGA
NM_001278547.1      CTGGGCTGCTGTAGATGA
NM_139049.2         CTGGGCTGCTGTAGATGA
NM_138982.2         CTGGGTTGTTGCAGGTGA
NM_002753.3         ------------------
                                      

Clone

Cloning Information : 57664
HIP Master Clone ID : 35952
Original Clone ID : FLH057664.01L

Organism


Species Specific ID: 5602

Reagents

Labome : MAPK10-antibody