DNASU Plasmid Repository • 480.965.5697 | Email

PDGFB (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PDGFB
Gene Name:  platelet-derived growth factor beta polypeptide
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH057843.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00001184

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 726nts         Open reading frame : 1 to 726
Reference Sequence Alignment

ATGAATCGCTGCTGGGCGCTCTTCCTGTCTCTCTGCTGCTACCTGCGTCTGGTCAGCGCC
GAGGGGGACCCCATTCCCGAGGAGCTTTATGAGATGCTGAGTGACCACTCGATCCGCTCC
TTTGATGATCTCCAACGCCTGCTGCACGGAGACCCCGGAGAGGAAGATGGGGCCGAGTTG
GACCTGAACATGACCCGCTCCCACTCTGGAGGCGAGCTGGAGAGCTTGGCTCGTGGAAGA
AGGAGCCTGGGTTCCCTGACCATTGCTGAGCCGGCCATGATCGCCGAGTGCAAGACGCGC
ACCGAGGTGTTCGAGATCTCCCGGCGCCTCATAGACCGCACCAACGCCAACTTCCTGGTG
TGGCCGCCCTGTGTGGAGGTGCAGCGCTGCTCCGGCTGCTGCAACAACCGCAACGTGCAG
TGCCGCCCCACCCAGGTGCAGCTGCGACCTGTCCAGGTGAGAAAGATCGAGATTGTGCGG
AAGAAGCCAATCTTTAAGAAGGCCACGGTGACGCTGGAAGACCACCTGGCATGCAAGTGT
GAGACAGTGGCAGCTGCACGGCCTGTGACCCGAAGCCCGGGGGGTTCCCAGGAGCAGCGA
GCCAAAACGCCCCAAACTCGGGTGACCATTCGGACGGTGCGAGTCCGCCGGCCCCCCAAG
GGCAAGCACCGGAAATTCAAGCACACGCATGACAAGACGGCACTGAAGGAGACCCTTGGA
GCCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1748
Start on reference sequence 1023
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PDGFB
Symbol Nomenclature : PDGFB
SYNONYM : IBGC5; PDGF-2; PDGF2; SIS; SSV; c-sis
Designation : PDGF subunit B|PDGF, B chain|becaplermin|platelet-derived growth factor 2|platelet-derived growth factor B chain|platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog)|platelet-derived growth factor subunit B|platelet-derived growth factor, beta polypeptide (oncogene SIS)|proto-oncogene c-Sis
Full Nomenclature : platelet-derived growth factor beta polypeptide
GENEID : 5155
Locus Tag : LL22NC03-10C3.2
GI : 60815416
GenBank Accession : AY893306
HGNC : 8800
MIM : 190040
Vega : OTTHUMG00000151029
Target GenBank: NM_002608

 

Reference Sequence Alignment

  

HsCD00001184      ATGAATCGCTGCTGGGCGCTCTTCCTGTCTCTCTGCTGCTACCTGCGTCTGGTCAGCGCC
NM_002608.2       ATGAATCGCTGCTGGGCGCTCTTCCTGTCTCTCTGCTGCTACCTGCGTCTGGTCAGCGCC
NM_033016.2       ---------------------------------------------ATGTTTATCATGGGC
                                                               .   * .***  * *

HsCD00001184      GAGGGGGACCCCATTCCCGAGGAGCTTTATGAGATGCTGAGTGACCACTCGATCCGCTCC
NM_002608.2       GAGGGGGACCCCATTCCCGAGGAGCTTTATGAGATGCTGAGTGACCACTCGATCCGCTCC
NM_033016.2       CTCGGGGACCCCATTCCCGAGGAGCTTTATGAGATGCTGAGTGACCACTCGATCCGCTCC
                   : *********************************************************

HsCD00001184      TTTGATGATCTCCAACGCCTGCTGCACGGAGACCCCGGAGAGGAAGATGGGGCCGAGTTG
NM_002608.2       TTTGATGATCTCCAACGCCTGCTGCACGGAGACCCCGGAGAGGAAGATGGGGCCGAGTTG
NM_033016.2       TTTGATGATCTCCAACGCCTGCTGCACGGAGACCCCGGAGAGGAAGATGGGGCCGAGTTG
                  ************************************************************

HsCD00001184      GACCTGAACATGACCCGCTCCCACTCTGGAGGCGAGCTGGAGAGCTTGGCTCGTGGAAGA
NM_002608.2       GACCTGAACATGACCCGCTCCCACTCTGGAGGCGAGCTGGAGAGCTTGGCTCGTGGAAGA
NM_033016.2       GACCTGAACATGACCCGCTCCCACTCTGGAGGCGAGCTGGAGAGCTTGGCTCGTGGAAGA
                  ************************************************************

HsCD00001184      AGGAGCCTGGGTTCCCTGACCATTGCTGAGCCGGCCATGATCGCCGAGTGCAAGACGCGC
NM_002608.2       AGGAGCCTGGGTTCCCTGACCATTGCTGAGCCGGCCATGATCGCCGAGTGCAAGACGCGC
NM_033016.2       AGGAGCCTGGGTTCCCTGACCATTGCTGAGCCGGCCATGATCGCCGAGTGCAAGACGCGC
                  ************************************************************

HsCD00001184      ACCGAGGTGTTCGAGATCTCCCGGCGCCTCATAGACCGCACCAACGCCAACTTCCTGGTG
NM_002608.2       ACCGAGGTGTTCGAGATCTCCCGGCGCCTCATAGACCGCACCAACGCCAACTTCCTGGTG
NM_033016.2       ACCGAGGTGTTCGAGATCTCCCGGCGCCTCATAGACCGCACCAACGCCAACTTCCTGGTG
                  ************************************************************

HsCD00001184      TGGCCGCCCTGTGTGGAGGTGCAGCGCTGCTCCGGCTGCTGCAACAACCGCAACGTGCAG
NM_002608.2       TGGCCGCCCTGTGTGGAGGTGCAGCGCTGCTCCGGCTGCTGCAACAACCGCAACGTGCAG
NM_033016.2       TGGCCGCCCTGTGTGGAGGTGCAGCGCTGCTCCGGCTGCTGCAACAACCGCAACGTGCAG
                  ************************************************************

HsCD00001184      TGCCGCCCCACCCAGGTGCAGCTGCGACCTGTCCAGGTGAGAAAGATCGAGATTGTGCGG
NM_002608.2       TGCCGCCCCACCCAGGTGCAGCTGCGACCTGTCCAGGTGAGAAAGATCGAGATTGTGCGG
NM_033016.2       TGCCGCCCCACCCAGGTGCAGCTGCGACCTGTCCAGGTGAGAAAGATCGAGATTGTGCGG
                  ************************************************************

HsCD00001184      AAGAAGCCAATCTTTAAGAAGGCCACGGTGACGCTGGAAGACCACCTGGCATGCAAGTGT
NM_002608.2       AAGAAGCCAATCTTTAAGAAGGCCACGGTGACGCTGGAAGACCACCTGGCATGCAAGTGT
NM_033016.2       AAGAAGCCAATCTTTAAGAAGGCCACGGTGACGCTGGAAGACCACCTGGCATGCAAGTGT
                  ************************************************************

HsCD00001184      GAGACAGTGGCAGCTGCACGGCCTGTGACCCGAAGCCCGGGGGGTTCCCAGGAGCAGCGA
NM_002608.2       GAGACAGTGGCAGCTGCACGGCCTGTGACCCGAAGCCCGGGGGGTTCCCAGGAGCAGCGA
NM_033016.2       GAGACAGTGGCAGCTGCACGGCCTGTGACCCGAAGCCCGGGGGGTTCCCAGGAGCAGCGA
                  ************************************************************

HsCD00001184      GCCAAAACGCCCCAAACTCGGGTGACCATTCGGACGGTGCGAGTCCGCCGGCCCCCCAAG
NM_002608.2       GCCAAAACGCCCCAAACTCGGGTGACCATTCGGACGGTGCGAGTCCGCCGGCCCCCCAAG
NM_033016.2       GCCAAAACGCCCCAAACTCGGGTGACCATTCGGACGGTGCGAGTCCGCCGGCCCCCCAAG
                  ************************************************************

HsCD00001184      GGCAAGCACCGGAAATTCAAGCACACGCATGACAAGACGGCACTGAAGGAGACCCTTGGA
NM_002608.2       GGCAAGCACCGGAAATTCAAGCACACGCATGACAAGACGGCACTGAAGGAGACCCTTGGA
NM_033016.2       GGCAAGCACCGGAAATTCAAGCACACGCATGACAAGACGGCACTGAAGGAGACCCTTGGA
                  ************************************************************

HsCD00001184      GCCTAG
NM_002608.2       GCCTAG
NM_033016.2       GCCTAG
                  ******

Pathways

NCI : Beta3 integrin cell surface interactions
NCI : Nectin adhesion pathway
NCI : PDGF receptor signaling network
NCI : PDGFR-beta signaling pathway
NCI : S1P1 pathway
NCI : S1P3 pathway
NCI : SHP2 signaling
NCI : Signaling events mediated by PTP1B
NCI : Signaling events mediated by TCPTP
Panther : Angiogenesis
Panther : PDGF signaling pathway
Reactome : Adaptive Immune System
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Extracellular matrix organization
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : Hemostasis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Non-integrin membrane-ECM interactions
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Platelet activation, signaling and aggregation
Reactome : Platelet degranulation
Reactome : Response to elevated platelet cytosolic Ca2+
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
WikiPathway : Angiogenesis
WikiPathway : Focal Adhesion
WikiPathway : MAPK signaling pathway
WikiPathway : Osteoblast Signaling
WikiPathway : Osteoclast Signaling
WikiPathway : Regulation of Actin Cytoskeleton

Clone

Cloning Information : 57843
HIP Master Clone ID : 36131
Original Clone ID : FLH057843.01X

Organism


TAX_ID : 9606
Species Specific ID: 5155

Genome

Chromosome : 22
Map Location : 22q13.1
Ensembl : ENSG00000100311

Reagents

Labome : PDGFB-antibody