DNASU Plasmid Repository • 480.965.5697 | Email

LYN (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  LYN
Gene Name:  v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH000145.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00001190

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1539nts         Open reading frame : 1 to 1539
Reference Sequence Alignment

ATGGGATGTATAAAATCAAAAGGGAAAGACAGCTTGAGTGACGATGGAGTAGATTTGAAG
ACTCAACCAGTACGTAATACTGAAAGAACTATTTATGTGAGAGATCCAACGTCCAATAAA
CAGCAAAGGCCAGTTCCAGAATCTCAGCTTTTACCTGGACAGAGGTTTCAAACTAAAGAT
CCAGAGGAACAAGGAGACATTGTGGTAGCCTTGTACCCCTATGATGGCATCCACCCGGAC
GACTTGTCTTTCAAGAAAGGAGAGAAGATGAAAGTCCTGGAGGAGCATGGAGAATGGTGG
AAAGCAAAGTCCCTTTTAACAAAAAAAGAAGGCTTCATCCCCAGCAACTATGTGGCCAAA
CTCAACACCTTAGAAACAGAAGAGTGGTTTTTCAAGGATATAACCAGGAAGGACGCAGAA
AGGCAGCTTTTGGCACCAGGAAATAGCGCTGGAGCTTTCCTTATTAGAGAAAGTGAAACA
TTAAAAGGAAGCTTCTCTCTGTCTGTCAGAGACTTTGACCCTGTGCATGGTGATGTTATT
AAGCACTACAAAATTAGAAGTCTGGATAATGGGGGCTATTACATCTCTCCACGAATCACT
TTTCCCTGTATCAGCGACATGATTAAACATTACCAAAAGCAGGCAGATGGCTTGTGCAGA
AGATTGGAGAAGGCTTGTATTAGTCCCAAGCCACAGAAGCCATGGGATAAAGATGCCTGG
GAGATCCCCCGGGAGTCCATCAAGTTGGTGAAAAGGCTTGGCGCTGGGCAGTTTGGGGAA
GTCTGGATGGGTTACTATAACAACAGTACCAAGGTGGCTGTGAAAACCCTGAAGCCAGGA
ACTATGTCTGTGCAAGCCTTCCTGGAAGAAGCCAACCTCATGAAGACCCTGCAGCATGAC
AAGCTCGTGAGGCTCTACGCTGTGGTCACCAGGGAGGAGCCCATTTACATCATCACCGAG
TACATGGCCAAGGGCAGTTTGCTGGATTTCCTGAAGAGCGATGAAGGTGGCAAAGTGCTG
CTTCCAAAGCTCATTGACTTTTCTGCTCAGATTGCAGAGGGAATGGCATACATCGAGCGG
AAGAACTACATTCACCGGGACCTGCGAGCAGCTAATGTTCTGGTCTCCGAGTCACTCATG
TGCAAAATTGCAGATTTTGGCCTTGCTAGAGTAATTGAAGATAATGAGTACACAGCAAGG
GAAGGTGCTAAGTTCCCTATTAAGTGGACGGCTCCAGAAGCAATCAACTTTGGATGTTTC
ACTATTAAGTCTGATGTGTGGTCCTTTGGAATCCTCCTATACGAAATTGTCACCTATGGG
AAAATTCCCTACCCAGGGAGAACTAATGCCGACGTGATGACCGCCCTGTCCCAGGGCTAC
AGGATGCCCCGTGTGGAGAACTGCCCAGATGAGCTCTATGACATTATGAAAATGTGCTGG
AAAGAAAAGGCAGAAGAGAGACCAACGTTTGACTACTTACAGAGCGTCCTGGATGATTTC
TACACAGCCACGGAAGGGCAATACCAGCAGCAGCCTTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1836
Start on reference sequence 298
Mutations:
None
Discrepancy:
a1137c
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : LYN
Symbol Nomenclature : LYN
SYNONYM : JTK8; p53Lyn; p56Lyn
Designation : lck/Yes-related novel protein tyrosine kinase|tyrosine-protein kinase Lyn
Full Nomenclature : v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
GENEID : 4067
GI : 33304202
GenBank Accession : AY335782
HGNC : 6735
MIM : 165120
Vega : OTTHUMG00000044345
Target GenBank: NM_002350

 

Reference Sequence Alignment

  

HsCD00001190        ATGGGATGTATAAAATCAAAAGGGAAAGACAGCTTGAGTGACGATGGAGTAGATTTGAAG
NM_001111097.2      ATGGGATGTATAAAATCAAAAGGGAAAGACAGCTTGAGTGACGATGGAGTAGATTTGAAG
NM_002350.3         ATGGGATGTATAAAATCAAAAGGGAAAGACAGCTTGAGTGACGATGGAGTAGATTTGAAG
                    ************************************************************

HsCD00001190        ACTCAACCAGTACGTAATACTGAAAGAACTATTTATGTGAGAGATCCAACGTCCAATAAA
NM_001111097.2      ACTCAACCAG--------------------------------------------------
NM_002350.3         ACTCAACCAGTACGTAATACTGAAAGAACTATTTATGTGAGAGATCCAACGTCCAATAAA
                    **********                                                  

HsCD00001190        CAGCAAAGGCCAGTTCCAGAATCTCAGCTTTTACCTGGACAGAGGTTTCAAACTAAAGAT
NM_001111097.2      -------------TTCCAGAATCTCAGCTTTTACCTGGACAGAGGTTTCAAACTAAAGAT
NM_002350.3         CAGCAAAGGCCAGTTCCAGAATCTCAGCTTTTACCTGGACAGAGGTTTCAAACTAAAGAT
                                 ***********************************************

HsCD00001190        CCAGAGGAACAAGGAGACATTGTGGTAGCCTTGTACCCCTATGATGGCATCCACCCGGAC
NM_001111097.2      CCAGAGGAACAAGGAGACATTGTGGTAGCCTTGTACCCCTATGATGGCATCCACCCGGAC
NM_002350.3         CCAGAGGAACAAGGAGACATTGTGGTAGCCTTGTACCCCTATGATGGCATCCACCCGGAC
                    ************************************************************

HsCD00001190        GACTTGTCTTTCAAGAAAGGAGAGAAGATGAAAGTCCTGGAGGAGCATGGAGAATGGTGG
NM_001111097.2      GACTTGTCTTTCAAGAAAGGAGAGAAGATGAAAGTCCTGGAGGAGCATGGAGAATGGTGG
NM_002350.3         GACTTGTCTTTCAAGAAAGGAGAGAAGATGAAAGTCCTGGAGGAGCATGGAGAATGGTGG
                    ************************************************************

HsCD00001190        AAAGCAAAGTCCCTTTTAACAAAAAAAGAAGGCTTCATCCCCAGCAACTATGTGGCCAAA
NM_001111097.2      AAAGCAAAGTCCCTTTTAACAAAAAAAGAAGGCTTCATCCCCAGCAACTATGTGGCCAAA
NM_002350.3         AAAGCAAAGTCCCTTTTAACAAAAAAAGAAGGCTTCATCCCCAGCAACTATGTGGCCAAA
                    ************************************************************

HsCD00001190        CTCAACACCTTAGAAACAGAAGAGTGGTTTTTCAAGGATATAACCAGGAAGGACGCAGAA
NM_001111097.2      CTCAACACCTTAGAAACAGAAGAGTGGTTTTTCAAGGATATAACCAGGAAGGACGCAGAA
NM_002350.3         CTCAACACCTTAGAAACAGAAGAGTGGTTTTTCAAGGATATAACCAGGAAGGACGCAGAA
                    ************************************************************

HsCD00001190        AGGCAGCTTTTGGCACCAGGAAATAGCGCTGGAGCTTTCCTTATTAGAGAAAGTGAAACA
NM_001111097.2      AGGCAGCTTTTGGCACCAGGAAATAGCGCTGGAGCTTTCCTTATTAGAGAAAGTGAAACA
NM_002350.3         AGGCAGCTTTTGGCACCAGGAAATAGCGCTGGAGCTTTCCTTATTAGAGAAAGTGAAACA
                    ************************************************************

HsCD00001190        TTAAAAGGAAGCTTCTCTCTGTCTGTCAGAGACTTTGACCCTGTGCATGGTGATGTTATT
NM_001111097.2      TTAAAAGGAAGCTTCTCTCTGTCTGTCAGAGACTTTGACCCTGTGCATGGTGATGTTATT
NM_002350.3         TTAAAAGGAAGCTTCTCTCTGTCTGTCAGAGACTTTGACCCTGTGCATGGTGATGTTATT
                    ************************************************************

HsCD00001190        AAGCACTACAAAATTAGAAGTCTGGATAATGGGGGCTATTACATCTCTCCACGAATCACT
NM_001111097.2      AAGCACTACAAAATTAGAAGTCTGGATAATGGGGGCTATTACATCTCTCCACGAATCACT
NM_002350.3         AAGCACTACAAAATTAGAAGTCTGGATAATGGGGGCTATTACATCTCTCCACGAATCACT
                    ************************************************************

HsCD00001190        TTTCCCTGTATCAGCGACATGATTAAACATTACCAAAAGCAGGCAGATGGCTTGTGCAGA
NM_001111097.2      TTTCCCTGTATCAGCGACATGATTAAACATTACCAAAAGCAGGCAGATGGCTTGTGCAGA
NM_002350.3         TTTCCCTGTATCAGCGACATGATTAAACATTACCAAAAGCAGGCAGATGGCTTGTGCAGA
                    ************************************************************

HsCD00001190        AGATTGGAGAAGGCTTGTATTAGTCCCAAGCCACAGAAGCCATGGGATAAAGATGCCTGG
NM_001111097.2      AGATTGGAGAAGGCTTGTATTAGTCCCAAGCCACAGAAGCCATGGGATAAAGATGCCTGG
NM_002350.3         AGATTGGAGAAGGCTTGTATTAGTCCCAAGCCACAGAAGCCATGGGATAAAGATGCCTGG
                    ************************************************************

HsCD00001190        GAGATCCCCCGGGAGTCCATCAAGTTGGTGAAAAGGCTTGGCGCTGGGCAGTTTGGGGAA
NM_001111097.2      GAGATCCCCCGGGAGTCCATCAAGTTGGTGAAAAGGCTTGGCGCTGGGCAGTTTGGGGAA
NM_002350.3         GAGATCCCCCGGGAGTCCATCAAGTTGGTGAAAAGGCTTGGCGCTGGGCAGTTTGGGGAA
                    ************************************************************

HsCD00001190        GTCTGGATGGGTTACTATAACAACAGTACCAAGGTGGCTGTGAAAACCCTGAAGCCAGGA
NM_001111097.2      GTCTGGATGGGTTACTATAACAACAGTACCAAGGTGGCTGTGAAAACCCTGAAGCCAGGA
NM_002350.3         GTCTGGATGGGTTACTATAACAACAGTACCAAGGTGGCTGTGAAAACCCTGAAGCCAGGA
                    ************************************************************

HsCD00001190        ACTATGTCTGTGCAAGCCTTCCTGGAAGAAGCCAACCTCATGAAGACCCTGCAGCATGAC
NM_001111097.2      ACTATGTCTGTGCAAGCCTTCCTGGAAGAAGCCAACCTCATGAAGACCCTGCAGCATGAC
NM_002350.3         ACTATGTCTGTGCAAGCCTTCCTGGAAGAAGCCAACCTCATGAAGACCCTGCAGCATGAC
                    ************************************************************

HsCD00001190        AAGCTCGTGAGGCTCTACGCTGTGGTCACCAGGGAGGAGCCCATTTACATCATCACCGAG
NM_001111097.2      AAGCTCGTGAGGCTCTACGCTGTGGTCACCAGGGAGGAGCCCATTTACATCATCACCGAG
NM_002350.3         AAGCTCGTGAGGCTCTACGCTGTGGTCACCAGGGAGGAGCCCATTTACATCATCACCGAG
                    ************************************************************

HsCD00001190        TACATGGCCAAGGGCAGTTTGCTGGATTTCCTGAAGAGCGATGAAGGTGGCAAAGTGCTG
NM_001111097.2      TACATGGCCAAGGGCAGTTTGCTGGATTTCCTGAAGAGCGATGAAGGTGGCAAAGTGCTG
NM_002350.3         TACATGGCCAAGGGCAGTTTGCTGGATTTCCTGAAGAGCGATGAAGGTGGCAAAGTGCTG
                    ************************************************************

HsCD00001190        CTTCCAAAGCTCATTGACTTTTCTGCTCAGATTGCAGAGGGAATGGCATACATCGAGCGG
NM_001111097.2      CTTCCAAAGCTCATTGACTTTTCTGCTCAGATTGCAGAGGGAATGGCATACATCGAGCGG
NM_002350.3         CTTCCAAAGCTCATTGACTTTTCTGCTCAGATTGCAGAGGGAATGGCATACATCGAGCGG
                    ************************************************************

HsCD00001190        AAGAACTACATTCACCGGGACCTGCGAGCAGCTAATGTTCTGGTCTCCGAGTCACTCATG
NM_001111097.2      AAGAACTACATTCACCGGGACCTGCGAGCAGCTAATGTTCTGGTCTCCGAGTCACTCATG
NM_002350.3         AAGAACTACATTCACCGGGACCTGCGAGCAGCTAATGTTCTGGTCTCCGAGTCACTCATG
                    ************************************************************

HsCD00001190        TGCAAAATTGCAGATTTTGGCCTTGCTAGAGTAATTGAAGATAATGAGTACACAGCAAGG
NM_001111097.2      TGCAAAATTGCAGATTTTGGCCTTGCTAGAGTAATTGAAGATAATGAGTACACAGCAAGG
NM_002350.3         TGCAAAATTGCAGATTTTGGCCTTGCTAGAGTAATTGAAGATAATGAGTACACAGCAAGG
                    ************************************************************

HsCD00001190        GAAGGTGCTAAGTTCCCTATTAAGTGGACGGCTCCAGAAGCAATCAACTTTGGATGTTTC
NM_001111097.2      GAAGGTGCTAAGTTCCCTATTAAGTGGACGGCTCCAGAAGCAATCAACTTTGGATGTTTC
NM_002350.3         GAAGGTGCTAAGTTCCCTATTAAGTGGACGGCTCCAGAAGCAATCAACTTTGGATGTTTC
                    ************************************************************

HsCD00001190        ACTATTAAGTCTGATGTGTGGTCCTTTGGAATCCTCCTATACGAAATTGTCACCTATGGG
NM_001111097.2      ACTATTAAGTCTGATGTGTGGTCCTTTGGAATCCTCCTATACGAAATTGTCACCTATGGG
NM_002350.3         ACTATTAAGTCTGATGTGTGGTCCTTTGGAATCCTCCTATACGAAATTGTCACCTATGGG
                    ************************************************************

HsCD00001190        AAAATTCCCTACCCAGGGAGAACTAATGCCGACGTGATGACCGCCCTGTCCCAGGGCTAC
NM_001111097.2      AAAATTCCCTACCCAGGGAGAACTAATGCCGACGTGATGACCGCCCTGTCCCAGGGCTAC
NM_002350.3         AAAATTCCCTACCCAGGGAGAACTAATGCCGACGTGATGACCGCCCTGTCCCAGGGCTAC
                    ************************************************************

HsCD00001190        AGGATGCCCCGTGTGGAGAACTGCCCAGATGAGCTCTATGACATTATGAAAATGTGCTGG
NM_001111097.2      AGGATGCCCCGTGTGGAGAACTGCCCAGATGAGCTCTATGACATTATGAAAATGTGCTGG
NM_002350.3         AGGATGCCCCGTGTGGAGAACTGCCCAGATGAGCTCTATGACATTATGAAAATGTGCTGG
                    ************************************************************

HsCD00001190        AAAGAAAAGGCAGAAGAGAGACCAACGTTTGACTACTTACAGAGCGTCCTGGATGATTTC
NM_001111097.2      AAAGAAAAGGCAGAAGAGAGACCAACGTTTGACTACTTACAGAGCGTCCTGGATGATTTC
NM_002350.3         AAAGAAAAGGCAGAAGAGAGACCAACGTTTGACTACTTACAGAGCGTCCTGGATGATTTC
                    ************************************************************

HsCD00001190        TACACAGCCACGGAAGGGCAATACCAGCAGCAGCCTTTG
NM_001111097.2      TACACAGCCACGGAAGGGCAATACCAGCAGCAGCCTTAG
NM_002350.3         TACACAGCCACGGAAGGGCAATACCAGCAGCAGCCTTAG
                    *************************************:*

Pathways

NCI : Alpha-synuclein signaling
NCI : BCR signaling pathway
NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : EPHA forward signaling
NCI : EPO signaling pathway
NCI : Ephrin B reverse signaling
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : GMCSF-mediated signaling events
NCI : Glypican 1 network
NCI : IL5-mediated signaling events
NCI : IL8- and CXCR1-mediated signaling events
NCI : IL8- and CXCR2-mediated signaling events
NCI : LPA receptor mediated events
NCI : PDGFR-beta signaling pathway
NCI : Regulation of p38-alpha and p38-beta
NCI : Signaling events mediated by PTP1B
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : Thromboxane A2 receptor signaling
NCI : amb2 Integrin signaling
Panther : B cell activation
Panther : Parkinson disease
Reactome : Adaptive Immune System
Reactome : Antigen activates B Cell Receptor (BCR) leading to generation of second messengers
Reactome : CD28 co-stimulation
Reactome : CTLA4 inhibitory signaling
Reactome : Cell surface interactions at the vascular wall
Reactome : Costimulation by the CD28 family
Reactome : Cytokine Signaling in Immune system
Reactome : FCERI mediated Ca+2 mobilization
Reactome : FCERI mediated MAPK activation
Reactome : FCERI mediated NF-kB activation
Reactome : FCGR activation
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : GPVI-mediated activation cascade
Reactome : Growth hormone receptor signaling
Reactome : Hemostasis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : PECAM1 interactions
Reactome : Platelet Adhesion to exposed collagen
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of KIT signaling
Reactome : Regulation of signaling by CBL
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Signal Transduction
Reactome : Signaling by Interleukins
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : IL-3 Signaling Pathway
WikiPathway : IL-5 signaling pathway
WikiPathway : Kit receptor signaling pathway
WikiPathway : RANKL/RANK Signaling Pathway

Clone

Cloning Information : 145
HIP Master Clone ID : 87203
Original Clone ID : FLH000145.01L

Organism


TAX_ID : 9606
Species Specific ID: 4067

Genome

Chromosome : 8
Map Location : 8q13
Ensembl : ENSG00000254087

Reagents

Labome : Lyn-antibody