DNASU Plasmid Repository • 480.965.5697 | Email

PPID (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PPID
Gene Name:  peptidylprolyl isomerase D
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH019182.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00001211

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1113nts         Open reading frame : 1 to 1113
Reference Sequence Alignment

ATGTCGCACCCGTCCCCCCAAGCCAAGCCCTCCAACCCCAGTAACCCTCGAGTCTTCTTT
GACGTGGACATCGGAGGGGAGCGAGTTGGTCGAATTGTCTTAGAATTGTTTGCAGATATC
GTACCCAAAACTGCGGAAAATTTTCGTGCACTGTGTACAGGAGAAAAAGGCATTGGACAC
ACGACTGGGAAACCTCTCCATTTCAAAGGATGCCCTTTTCATCGAATTATTAAGAAATTT
ATGATTCAGGGTGGAGACTTCTCAAATCAGAATGGGACAGGTGGAGAAAGTATTTATGGT
GAAAAATTTGAAGATGAAAATTTCCATTACAAGCATGATCGGGAGGGTTTACTGAGCATG
GCAAATGCAGGCCGCAACACAAACGGTTCTCAGTTTTTTATCACAACAGTTCCAACTCCT
CATTTGGATGGGAAACATGTGGTGTTTGGCCAAGTAATTAAAGGAATAGGAGTGGCAAGG
ATATTGGAAAATGTGGAAGTGAAAGGTGAAAAACCTGCTAAATTGTGCGTTATTGCAGAA
TGTGGAGAATTGAAGGAAGGAGATGACGGGGGAATATTCCCAAAAGATGGCTCTGGCGAC
AGTCATCCAGATTTCCCTGAGGATGCGGATATAGATTTAAAAGATGTAGATAAAATTTTA
TTAATAACAGAAGACTTAAAAAACATTGGAAATACTTTTTTCAAATCCCAGAACTGGGAG
ATGGCTATTAAAAAATCTGCAGAAGTTTTAAGATACGTGGACAGTTCAAAGGCTGTTATT
GAGACAGCAGATAGAGCCAAGCTGCAACCTATAGCTTTAAGCTGTGTACTGAATATTGGT
GCTTGTAAACTGAAGATGTCAAATTGGCAGGGAGCAATTGACAGTTGTTTAGAGGCTCTT
GAACTAGACCCATCAAATACCAAAGCATTGTACCGCAGAGCTCAAGGATGGCAAGGATTA
AAAGAATATGATCAAGCATTGGCTGATCTTAAGAAAGCTCAGGGGATAGCACCAGAAGAT
AAAGCTATCCAGGCAGAATTGCTGAAAGTCAAACAAAAGATAAAGGCACAGAAAGATAAA
GAGAAGGCAGTATATGCAAAAATGTTTGCTTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1212
Start on reference sequence 100
Mutations:
None
Discrepancy:
a737c,Y246S
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PPID
Symbol Nomenclature : PPID
SYNONYM : CYP-40; CYPD
Designation : 40 kDa peptidyl-prolyl cis-trans isomerase D|PPIase D|cyclophilin 40|cyclophilin D|cyclophilin-40|cyclophilin-related protein|peptidyl-prolyl cis-trans isomerase D|rotamase D
Full Nomenclature : peptidylprolyl isomerase D
GENEID : 5481
GI : 61368329
GenBank Accession : AY891228
HGNC : 9257
MIM : 601753
Vega : OTTHUMG00000161927
Target GenBank: NM_005038

 

Reference Sequence Alignment

  

HsCD00001211      ATGTCGCACCCGTCCCCCCAAGCCAAGCCCTCCAACCCCAGTAACCCTCGAGTCTTCTTT
NM_005038.2       ATGTCGCACCCGTCCCCCCAAGCCAAGCCCTCCAACCCCAGTAACCCTCGAGTCTTCTTT
                  ************************************************************

HsCD00001211      GACGTGGACATCGGAGGGGAGCGAGTTGGTCGAATTGTCTTAGAATTGTTTGCAGATATC
NM_005038.2       GACGTGGACATCGGAGGGGAGCGAGTTGGTCGAATTGTCTTAGAATTGTTTGCAGATATC
                  ************************************************************

HsCD00001211      GTACCCAAAACTGCGGAAAATTTTCGTGCACTGTGTACAGGAGAAAAAGGCATTGGACAC
NM_005038.2       GTACCCAAAACTGCGGAAAATTTTCGTGCACTGTGTACAGGAGAAAAAGGCATTGGACAC
                  ************************************************************

HsCD00001211      ACGACTGGGAAACCTCTCCATTTCAAAGGATGCCCTTTTCATCGAATTATTAAGAAATTT
NM_005038.2       ACGACTGGGAAACCTCTCCATTTCAAAGGATGCCCTTTTCATCGAATTATTAAGAAATTT
                  ************************************************************

HsCD00001211      ATGATTCAGGGTGGAGACTTCTCAAATCAGAATGGGACAGGTGGAGAAAGTATTTATGGT
NM_005038.2       ATGATTCAGGGTGGAGACTTCTCAAATCAGAATGGGACAGGTGGAGAAAGTATTTATGGT
                  ************************************************************

HsCD00001211      GAAAAATTTGAAGATGAAAATTTCCATTACAAGCATGATCGGGAGGGTTTACTGAGCATG
NM_005038.2       GAAAAATTTGAAGATGAAAATTTCCATTACAAGCATGATCGGGAGGGTTTACTGAGCATG
                  ************************************************************

HsCD00001211      GCAAATGCAGGCCGCAACACAAACGGTTCTCAGTTTTTTATCACAACAGTTCCAACTCCT
NM_005038.2       GCAAATGCAGGCCGCAACACAAACGGTTCTCAGTTTTTTATCACAACAGTTCCAACTCCT
                  ************************************************************

HsCD00001211      CATTTGGATGGGAAACATGTGGTGTTTGGCCAAGTAATTAAAGGAATAGGAGTGGCAAGG
NM_005038.2       CATTTGGATGGGAAACATGTGGTGTTTGGCCAAGTAATTAAAGGAATAGGAGTGGCAAGG
                  ************************************************************

HsCD00001211      ATATTGGAAAATGTGGAAGTGAAAGGTGAAAAACCTGCTAAATTGTGCGTTATTGCAGAA
NM_005038.2       ATATTGGAAAATGTGGAAGTGAAAGGTGAAAAACCTGCTAAATTGTGCGTTATTGCAGAA
                  ************************************************************

HsCD00001211      TGTGGAGAATTGAAGGAAGGAGATGACGGGGGAATATTCCCAAAAGATGGCTCTGGCGAC
NM_005038.2       TGTGGAGAATTGAAGGAAGGAGATGACGGGGGAATATTCCCAAAAGATGGCTCTGGCGAC
                  ************************************************************

HsCD00001211      AGTCATCCAGATTTCCCTGAGGATGCGGATATAGATTTAAAAGATGTAGATAAAATTTTA
NM_005038.2       AGTCATCCAGATTTCCCTGAGGATGCGGATATAGATTTAAAAGATGTAGATAAAATTTTA
                  ************************************************************

HsCD00001211      TTAATAACAGAAGACTTAAAAAACATTGGAAATACTTTTTTCAAATCCCAGAACTGGGAG
NM_005038.2       TTAATAACAGAAGACTTAAAAAACATTGGAAATACTTTTTTCAAATCCCAGAACTGGGAG
                  ************************************************************

HsCD00001211      ATGGCTATTAAAAAATCTGCAGAAGTTTTAAGATACGTGGACAGTTCAAAGGCTGTTATT
NM_005038.2       ATGGCTATTAAAAAATATGCAGAAGTTTTAAGATACGTGGACAGTTCAAAGGCTGTTATT
                  ****************.*******************************************

HsCD00001211      GAGACAGCAGATAGAGCCAAGCTGCAACCTATAGCTTTAAGCTGTGTACTGAATATTGGT
NM_005038.2       GAGACAGCAGATAGAGCCAAGCTGCAACCTATAGCTTTAAGCTGTGTACTGAATATTGGT
                  ************************************************************

HsCD00001211      GCTTGTAAACTGAAGATGTCAAATTGGCAGGGAGCAATTGACAGTTGTTTAGAGGCTCTT
NM_005038.2       GCTTGTAAACTGAAGATGTCAAATTGGCAGGGAGCAATTGACAGTTGTTTAGAGGCTCTT
                  ************************************************************

HsCD00001211      GAACTAGACCCATCAAATACCAAAGCATTGTACCGCAGAGCTCAAGGATGGCAAGGATTA
NM_005038.2       GAACTAGACCCATCAAATACCAAAGCATTGTACCGCAGAGCTCAAGGATGGCAAGGATTA
                  ************************************************************

HsCD00001211      AAAGAATATGATCAAGCATTGGCTGATCTTAAGAAAGCTCAGGGGATAGCACCAGAAGAT
NM_005038.2       AAAGAATATGATCAAGCATTGGCTGATCTTAAGAAAGCTCAGGGGATAGCACCAGAAGAT
                  ************************************************************

HsCD00001211      AAAGCTATCCAGGCAGAATTGCTGAAAGTCAAACAAAAGATAAAGGCACAGAAAGATAAA
NM_005038.2       AAAGCTATCCAGGCAGAATTGCTGAAAGTCAAACAAAAGATAAAGGCACAGAAAGATAAA
                  ************************************************************

HsCD00001211      GAGAAGGCAGTATATGCAAAAATGTTTGCTTTG
NM_005038.2       GAGAAGGCAGTATATGCAAAAATGTTTGCTTAG
                  *******************************:*

Pathways

NCI : C-MYB transcription factor network

Protein

SMART domain : TPR : Tetratricopeptide repeats
UniProt : Q08752
UniProt : E5KN55
HPRD : 11875

Clone

Cloning Information : 19182
HIP Master Clone ID : 33381
Original Clone ID : FLH019182.01L

Organism


TAX_ID : 9606
Species Specific ID: 5481

Genome

Chromosome : 4
Map Location : 4q31.3
Ensembl : ENSG00000171497

Reagents

Labome : PPID-antibody