DNASU Plasmid Repository • 480.965.5697 | Email

CCND1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CCND1
Gene Name:  cyclin D1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH019447.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00001253

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 888nts         Open reading frame : 1 to 888
Reference Sequence Alignment

ATGGAACACCAGCTCCTGTGCTGCGAAGTGGAAACCATCCGCCGCGCGTACCCCGATGCC
AACCTCCTCAACGACCGGGTGCTGCGGGCCATGCTGAAGGCGGAGGAGACCTGCGCGCCC
TCGGTGTCCTACTTCAAATGTGTGCAGAAGGAGGTCCTGCCGTCCATGCGGAAGATCGTC
GCCACCTGGATGCTGGAGGTCTGCGAGGAACAGAAGTGCGAGGAGGAGGTCTTCCCGCTG
GCCATGAACTACCTGGACCGCTTCCTGTCGCTGGAGCCCGTGAAAAAGAGCCGCCTGCAG
CTGCTGGGGGCCACTTGCATGTTCGTGGCCTCTAAGATGAAGGAGACCATCCCCCTGACG
GCCGAGAAGCTGTGCATCTACACCGACAACTCCATCCGGCCCGAGGAGCTGCTGCAAATG
GAGCTGCTCCTGGTGAACAAGCTCAAGTGGAACCTGGCCGCAATGACCCCGCACGATTTC
ATTGAACACTTCCTCTCCAAAATGCCAGAGGCGGAGGAGAACAAACAGATCATCCGCAAA
CACGCGCAGACCTTCGTTGCCCTCTGTGCCACAGATGTGAAGTTCATTTCCAATCCGCCC
TCCATGGTGGCAGCGGGGAGCGTGGTGGCCGCAGTGCAAGGCCTGAACCTGAGGAGCCCC
AACAACTTCCTGTCCTACTACCGCCTCACACGCTTCCTCTCCAGAGTGATCAAGTGTGAC
CCGGACTGCCTCCGGGCCTGCCAGGAGCAGATCGAAGCCCTGCTGGAGTCAAGCCTGCGC
CAGGCCCAGCAGAACATGGACCCCAAGGCCGCCGAGGAGGAGGAAGAGGAGGAGGAGGAG
GTGGACCTGGCTTGCACACCCACCGACGTGCGGGACGTGGACATCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1033
Start on reference sequence 146
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CCND1
Symbol Nomenclature : CCND1
SYNONYM : BCL1; D11S287E; PRAD1; U21B31
Designation : B-cell CLL/lymphoma 1|B-cell lymphoma 1 protein|BCL-1 oncogene|G1/S-specific cyclin-D1|PRAD1 oncogene
Full Nomenclature : cyclin D1
GENEID : 595
GI : 61368366
GenBank Accession : AY891237
HGNC : 1582
MIM : 168461
Vega : OTTHUMG00000167877
Target GenBank: BC025302

 

Reference Sequence Alignment

  

HsCD00001253      ATGGAACACCAGCTCCTGTGCTGCGAAGTGGAAACCATCCGCCGCGCGTACCCCGATGCC
NM_053056.2       ATGGAACACCAGCTCCTGTGCTGCGAAGTGGAAACCATCCGCCGCGCGTACCCCGATGCC
                  ************************************************************

HsCD00001253      AACCTCCTCAACGACCGGGTGCTGCGGGCCATGCTGAAGGCGGAGGAGACCTGCGCGCCC
NM_053056.2       AACCTCCTCAACGACCGGGTGCTGCGGGCCATGCTGAAGGCGGAGGAGACCTGCGCGCCC
                  ************************************************************

HsCD00001253      TCGGTGTCCTACTTCAAATGTGTGCAGAAGGAGGTCCTGCCGTCCATGCGGAAGATCGTC
NM_053056.2       TCGGTGTCCTACTTCAAATGTGTGCAGAAGGAGGTCCTGCCGTCCATGCGGAAGATCGTC
                  ************************************************************

HsCD00001253      GCCACCTGGATGCTGGAGGTCTGCGAGGAACAGAAGTGCGAGGAGGAGGTCTTCCCGCTG
NM_053056.2       GCCACCTGGATGCTGGAGGTCTGCGAGGAACAGAAGTGCGAGGAGGAGGTCTTCCCGCTG
                  ************************************************************

HsCD00001253      GCCATGAACTACCTGGACCGCTTCCTGTCGCTGGAGCCCGTGAAAAAGAGCCGCCTGCAG
NM_053056.2       GCCATGAACTACCTGGACCGCTTCCTGTCGCTGGAGCCCGTGAAAAAGAGCCGCCTGCAG
                  ************************************************************

HsCD00001253      CTGCTGGGGGCCACTTGCATGTTCGTGGCCTCTAAGATGAAGGAGACCATCCCCCTGACG
NM_053056.2       CTGCTGGGGGCCACTTGCATGTTCGTGGCCTCTAAGATGAAGGAGACCATCCCCCTGACG
                  ************************************************************

HsCD00001253      GCCGAGAAGCTGTGCATCTACACCGACAACTCCATCCGGCCCGAGGAGCTGCTGCAAATG
NM_053056.2       GCCGAGAAGCTGTGCATCTACACCGACAACTCCATCCGGCCCGAGGAGCTGCTGCAAATG
                  ************************************************************

HsCD00001253      GAGCTGCTCCTGGTGAACAAGCTCAAGTGGAACCTGGCCGCAATGACCCCGCACGATTTC
NM_053056.2       GAGCTGCTCCTGGTGAACAAGCTCAAGTGGAACCTGGCCGCAATGACCCCGCACGATTTC
                  ************************************************************

HsCD00001253      ATTGAACACTTCCTCTCCAAAATGCCAGAGGCGGAGGAGAACAAACAGATCATCCGCAAA
NM_053056.2       ATTGAACACTTCCTCTCCAAAATGCCAGAGGCGGAGGAGAACAAACAGATCATCCGCAAA
                  ************************************************************

HsCD00001253      CACGCGCAGACCTTCGTTGCCCTCTGTGCCACAGATGTGAAGTTCATTTCCAATCCGCCC
NM_053056.2       CACGCGCAGACCTTCGTTGCCCTCTGTGCCACAGATGTGAAGTTCATTTCCAATCCGCCC
                  ************************************************************

HsCD00001253      TCCATGGTGGCAGCGGGGAGCGTGGTGGCCGCAGTGCAAGGCCTGAACCTGAGGAGCCCC
NM_053056.2       TCCATGGTGGCAGCGGGGAGCGTGGTGGCCGCAGTGCAAGGCCTGAACCTGAGGAGCCCC
                  ************************************************************

HsCD00001253      AACAACTTCCTGTCCTACTACCGCCTCACACGCTTCCTCTCCAGAGTGATCAAGTGTGAC
NM_053056.2       AACAACTTCCTGTCCTACTACCGCCTCACACGCTTCCTCTCCAGAGTGATCAAGTGTGAC
                  ************************************************************

HsCD00001253      CCGGACTGCCTCCGGGCCTGCCAGGAGCAGATCGAAGCCCTGCTGGAGTCAAGCCTGCGC
NM_053056.2       CCGGACTGCCTCCGGGCCTGCCAGGAGCAGATCGAAGCCCTGCTGGAGTCAAGCCTGCGC
                  ************************************************************

HsCD00001253      CAGGCCCAGCAGAACATGGACCCCAAGGCCGCCGAGGAGGAGGAAGAGGAGGAGGAGGAG
NM_053056.2       CAGGCCCAGCAGAACATGGACCCCAAGGCCGCCGAGGAGGAGGAAGAGGAGGAGGAGGAG
                  ************************************************************

HsCD00001253      GTGGACCTGGCTTGCACACCCACCGACGTGCGGGACGTGGACATCTTG
NM_053056.2       GTGGACCTGGCTTGCACACCCACCGACGTGCGGGACGTGGACATCTGA
                  ********************************************** .

Pathways

NCI : AP-1 transcription factor network
NCI : ATF-2 transcription factor network
NCI : C-MYB transcription factor network
NCI : Coregulation of Androgen receptor activity
NCI : E-cadherin signaling in the nascent adherens junction
NCI : FOXM1 transcription factor network
NCI : Integrin-linked kinase signaling
NCI : Neurotrophic factor-mediated Trk receptor signaling
NCI : Notch signaling pathway
NCI : Presenilin action in Notch and Wnt signaling
NCI : Regulation of Telomerase
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Regulation of retinoblastoma protein
NCI : Signaling events mediated by focal adhesion kinase
NCI : Signaling mediated by p38-gamma and p38-delta
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : Validated nuclear estrogen receptor alpha network
NCI : Validated targets of C-MYC transcriptional repression
NCI : Validated transcriptional targets of AP1 family members Fra1 and Fra2
Panther : PI3 kinase pathway
Panther : Wnt signaling pathway
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cyclin D associated events in G1
Reactome : G1 Phase
Reactome : Mitotic G1-G1/S phases
Reactome : Pre-NOTCH Expression and Processing
Reactome : Pre-NOTCH Transcription and Translation
Reactome : S Phase
Reactome : Signal Transduction
Reactome : Signaling by NOTCH
Reactome : Ubiquitin-dependent degradation of Cyclin D
Reactome : Ubiquitin-dependent degradation of Cyclin D1
WikiPathway : Androgen receptor signaling pathway
WikiPathway : DNA damage response
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : Epithelium TarBase
WikiPathway : ErbB signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : G1 to S cell cycle control
WikiPathway : IL-7 signaling pathway
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Leptin signaling pathway
WikiPathway : Lymphocyte TarBase
WikiPathway : Muscle cell TarBase
WikiPathway : Notch Signaling Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : miRNAs involved in DDR

Protein

SMART domain : CYCLIN : domain present in cyclins, TFIIB and Retinoblastoma
UniProt : P24385
UniProt : Q6FI00
HPRD : 01346

Clone

Cloning Information : 19447
HIP Master Clone ID : 33646
Original Clone ID : FLH019447.01L

Organism


TAX_ID : 9606
Species Specific ID: 595

Genome

Chromosome : 11
Map Location : 11q13
Ensembl : ENSG00000110092

Reagents

Labome : cyclin-D1-antibody