DNASU Plasmid Repository • 480.965.5697 | Email

HRAS (Homo sapiens) in pDONR201 (Gateway donor/master vector)


Explanation of Terms

Gene: Gene Symbol:  HRAS
Gene Name:  Harvey rat sarcoma viral oncogene homolog
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH056751.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Discrepancy :
No / Yes
Publications: None
Authors: HIP

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 570nts         Open reading frame : 1 to 570
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 570
Start on reference sequence 1

5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : HRAS
Symbol Nomenclature : HRAS
Designation : GTP- and GDP-binding peptide B|GTPase HRas|H-Ras-1|Ha-Ras1 proto-oncoprotein|Ras family small GTP binding protein H-Ras|c-has/bas p21 protein|c-ras-Ki-2 activated oncogene|p19 H-RasIDX protein|p21ras|transformation gene: oncogene HAMSV|transforming protein p21|v-Ha-ras Harvey rat sarcoma viral oncogene homolog
Full Nomenclature : Harvey rat sarcoma viral oncogene homolog
GENEID : 3265
GI : 60816023
GenBank Accession : AY893330
HGNC : 5173
MIM : 190020
Vega : OTTHUMG00000131919
Target GenBank: NM_005343


Reference Sequence Alignment



                    ******************** ***************************************










NCI : BCR signaling pathway
NCI : C-MYB transcription factor network
NCI : CDC42 signaling events
NCI : CXCR3-mediated signaling events
NCI : Class I PI3K signaling events
NCI : Downstream signaling in naïve CD8+ T cells
NCI : EGF receptor (ErbB1) signaling pathway
NCI : EGFR-dependent Endothelin signaling events
NCI : EPHB forward signaling
NCI : EPO signaling pathway
NCI : Endothelins
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : GMCSF-mediated signaling events
NCI : IGF1 pathway
NCI : IL2-mediated signaling events
NCI : Insulin Pathway
NCI : Internalization of ErbB1
NCI : LPA receptor mediated events
NCI : Neurotrophic factor-mediated Trk receptor signaling
NCI : Nongenotropic Androgen signaling
NCI : PDGFR-beta signaling pathway
NCI : Plasma membrane estrogen receptor signaling
NCI : Posttranslational regulation of adherens junction stability and dissassembly
NCI : Ras signaling in the CD4+ TCR pathway
NCI : Regulation of Ras family activation
NCI : SHP2 signaling
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : Signaling events regulated by Ret tyrosine kinase
NCI : Syndecan-2-mediated signaling events
NCI : TCR signaling in naïve CD4+ T cells
NCI : TCR signaling in naïve CD8+ T cells
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : Trk receptor signaling mediated by the MAPK pathway
NCI : a6b1 and a6b4 Integrin signaling
NCI : mTOR signaling pathway
Panther : Angiogenesis
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : FGF signaling pathway
Panther : Integrin signalling pathway
Panther : PDGF signaling pathway
Panther : Ras Pathway
Panther : T cell activation
Panther : TGF-beta signaling pathway
Panther : VEGF signaling pathway
Panther : p53 pathway feedback loops 2
Reactome : ARMS-mediated activation
Reactome : Activation of NMDA receptor upon glutamate binding and postsynaptic events
Reactome : Activation of RAS in B cells
Reactome : Adaptive Immune System
Reactome : Axon guidance
Reactome : CREB phosphorylation through the activation of Ras
Reactome : Cell surface interactions at the vascular wall
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : EGFR Transactivation by Gastrin
Reactome : FCERI mediated MAPK activation
Reactome : FRS2-mediated cascade
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Frs2-mediated activation
Reactome : GRB2 events in EGFR signaling
Reactome : GRB2 events in ERBB2 signaling
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Hemostasis
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Interleukin receptor SHC signaling
Reactome : Interleukin-2 signaling
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : MEK activation
Reactome : NCAM signaling for neurite out-growth
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Post NMDA receptor activation events
Reactome : Prolonged ERK activation events
Reactome : RAF activation
Reactome : RAF phosphorylates MEK
Reactome : RAF/MAP kinase cascade
Reactome : Ras activation uopn Ca2+ infux through NMDA receptor
Reactome : SHC-mediated cascade
Reactome : SHC-mediated signalling
Reactome : SHC-related events
Reactome : SHC-related events triggered by IGF1R
Reactome : SHC1 events in EGFR signaling
Reactome : SHC1 events in ERBB2 signaling
Reactome : SHC1 events in ERBB4 signaling
Reactome : SOS-mediated signalling
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by FGFR mutants
Reactome : Signaling by GPCR
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Interleukins
Reactome : Signaling by Leptin
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signaling by constitutively active EGFR
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : Signalling to RAS
Reactome : Signalling to p38 via RIT and RIN
Reactome : Tie2 Signaling
Reactome : Transmission across Chemical Synapses
Reactome : p38MAPK events
WikiPathway : Alpha 6 Beta 4 signaling pathway
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : ErbB signaling pathway
WikiPathway : G Protein Signaling Pathways
WikiPathway : IL-2 Signaling pathway
WikiPathway : IL-3 Signaling Pathway
WikiPathway : Insulin Signaling
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : Kit receptor signaling pathway
WikiPathway : Leptin signaling pathway
WikiPathway : MAPK Cascade
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Senescence and Autophagy
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor
WikiPathway : TCR Signaling Pathway
WikiPathway : TGF Beta Signaling Pathway
WikiPathway : TSH signaling pathway
WikiPathway : p38 MAPK Signaling Pathway


Cloning Information : 56751
HIP Master Clone ID : 35039
Original Clone ID : FLH056751.01X


TAX_ID : 9606
Species Specific ID: 3265


Chromosome : 11
Map Location : 11p15.5
Ensembl : ENSG00000174775


Labome : H-Ras-antibody