DNASU Plasmid Repository • 480.965.5697 | Email

CDC37 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CDC37
Gene Name:  cell division cycle 37
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH019411.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00001267

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1137nts         Open reading frame : 1 to 1137
Reference Sequence Alignment

ATGGTGGACTACAGCGTGTGGGACCACATTGAGGTGTCTGATGATGAAGACGAGACGCAC
CCCAACATCGACACGGCCAGTCTCTTCCGCTGGCGGCATCAGGCCCGGGTGGAACGCATG
GAGCAGTTCCAGAAGGAGAAGGAGGAACTGGACAGGGGCTGCCGCGAGTGCAAGCGCAAG
GTGGCCGAGTGCCAGAGGAAACTGAAGGAGCTGGAGGTGGCCGAGGGCGGCAAGGCAGAG
CTGGAGCGCCTGCAGGCCGAGGCACAGCAGCTGCGCAAGGAGGAGCGGAGCTGGGAGCAG
AAGCTGGAGGAGATGCGCAAGAAGGAGAAGAGCATGCCCTGGAACGTGGACACGCTCAGC
AAAGACGGCTTCAGCAAGAGCATGGTAAATACCAAGCCCGAGAAGACGGAGGAGGACTCA
GAGGAGGTGAGGGAGCAGAAACACAAGACCTTCGTGGAAAAATACGAGAAACAGATCAAG
CACTTTGGCATGCTTCGCCGCTGGGATGACAGCCAAAAGTACCTGTCAGACAACGTCCAC
CTGGTGTGCGAGGAGACAGCCAATTACCTGGTCATTTGGTGCATTGACCTAGAGGTGGAG
GAGAAATGTGCACTCATGGAGCAGGTGGCCCACCAGACAATCGTCATGCAATTTATCCTG
GAGCTGGCCAAGAGCCTAAAGGTGGACCCCGGGGCCTGCTTCCGGCAGTTCTTCACTAAG
ATTAAGACAGCCGATCGCCAGTACATGGAGGGCTTCAACGACGAGCTGGAAGCCTTCAAG
GAGCGTGTGCGGGGCCGTGCCAAGCTGCGCATCGAGAAGGCCATGAAGGAGTACGAGGAG
GAGGAGCGCAAGAAGCGGCTCGGCCCCGGCGGCCTGGACCCCGTCGAGGTCTACGAGTCC
CTCCCTGAGGAACTCCAGAAGTGCTTCGATGTGAAGGACGTGCAGATGCTGCAGGACGCC
ATCAGCAAGATGGACCCCACCGACGCAAAGTACCACATGCAGCGCTGCATTGACTCTGGC
CTCTGGGTCCCCAACTCTAAGGCCAGCGAGGCCAAGGAGGGAGAGGAGGCAGGTCCTGGG
GACCCATTACTGGAAGCTGTTCCCAAGACGGGCGATGAGAAGGATGTCAGTGTGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1145
Start on reference sequence 9
Mutations:
None
Discrepancy:
c691g,R231G
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CDC37
Symbol Nomenclature : CDC37
SYNONYM : P50CDC37
Designation : CDC37 (cell division cycle 37, S. cerevisiae, homolog)|CDC37 cell division cycle 37 homolog|cell division cycle 37 homolog|hsp90 chaperone protein kinase-targeting subunit|hsp90 co-chaperone Cdc37
Full Nomenclature : cell division cycle 37
GENEID : 11140
GI : 61368390
GenBank Accession : AY891242
HGNC : 1735
MIM : 605065
Vega : OTTHUMG00000180578
Target GenBank: NM_007065

 

Reference Sequence Alignment

  

HsCD00001267      ATGGTGGACTACAGCGTGTGGGACCACATTGAGGTGTCTGATGATGAAGACGAGACGCAC
NM_007065.3       ATGGTGGACTACAGCGTGTGGGACCACATTGAGGTGTCTGATGATGAAGACGAGACGCAC
                  ************************************************************

HsCD00001267      CCCAACATCGACACGGCCAGTCTCTTCCGCTGGCGGCATCAGGCCCGGGTGGAACGCATG
NM_007065.3       CCCAACATCGACACGGCCAGTCTCTTCCGCTGGCGGCATCAGGCCCGGGTGGAACGCATG
                  ************************************************************

HsCD00001267      GAGCAGTTCCAGAAGGAGAAGGAGGAACTGGACAGGGGCTGCCGCGAGTGCAAGCGCAAG
NM_007065.3       GAGCAGTTCCAGAAGGAGAAGGAGGAACTGGACAGGGGCTGCCGCGAGTGCAAGCGCAAG
                  ************************************************************

HsCD00001267      GTGGCCGAGTGCCAGAGGAAACTGAAGGAGCTGGAGGTGGCCGAGGGCGGCAAGGCAGAG
NM_007065.3       GTGGCCGAGTGCCAGAGGAAACTGAAGGAGCTGGAGGTGGCCGAGGGCGGCAAGGCAGAG
                  ************************************************************

HsCD00001267      CTGGAGCGCCTGCAGGCCGAGGCACAGCAGCTGCGCAAGGAGGAGCGGAGCTGGGAGCAG
NM_007065.3       CTGGAGCGCCTGCAGGCCGAGGCACAGCAGCTGCGCAAGGAGGAGCGGAGCTGGGAGCAG
                  ************************************************************

HsCD00001267      AAGCTGGAGGAGATGCGCAAGAAGGAGAAGAGCATGCCCTGGAACGTGGACACGCTCAGC
NM_007065.3       AAGCTGGAGGAGATGCGCAAGAAGGAGAAGAGCATGCCCTGGAACGTGGACACGCTCAGC
                  ************************************************************

HsCD00001267      AAAGACGGCTTCAGCAAGAGCATGGTAAATACCAAGCCCGAGAAGACGGAGGAGGACTCA
NM_007065.3       AAAGACGGCTTCAGCAAGAGCATGGTAAATACCAAGCCCGAGAAGACGGAGGAGGACTCA
                  ************************************************************

HsCD00001267      GAGGAGGTGAGGGAGCAGAAACACAAGACCTTCGTGGAAAAATACGAGAAACAGATCAAG
NM_007065.3       GAGGAGGTGAGGGAGCAGAAACACAAGACCTTCGTGGAAAAATACGAGAAACAGATCAAG
                  ************************************************************

HsCD00001267      CACTTTGGCATGCTTCGCCGCTGGGATGACAGCCAAAAGTACCTGTCAGACAACGTCCAC
NM_007065.3       CACTTTGGCATGCTTCGCCGCTGGGATGACAGCCAAAAGTACCTGTCAGACAACGTCCAC
                  ************************************************************

HsCD00001267      CTGGTGTGCGAGGAGACAGCCAATTACCTGGTCATTTGGTGCATTGACCTAGAGGTGGAG
NM_007065.3       CTGGTGTGCGAGGAGACAGCCAATTACCTGGTCATTTGGTGCATTGACCTAGAGGTGGAG
                  ************************************************************

HsCD00001267      GAGAAATGTGCACTCATGGAGCAGGTGGCCCACCAGACAATCGTCATGCAATTTATCCTG
NM_007065.3       GAGAAATGTGCACTCATGGAGCAGGTGGCCCACCAGACAATCGTCATGCAATTTATCCTG
                  ************************************************************

HsCD00001267      GAGCTGGCCAAGAGCCTAAAGGTGGACCCCGGGGCCTGCTTCCGGCAGTTCTTCACTAAG
NM_007065.3       GAGCTGGCCAAGAGCCTAAAGGTGGACCCCCGGGCCTGCTTCCGGCAGTTCTTCACTAAG
                  ****************************** *****************************

HsCD00001267      ATTAAGACAGCCGATCGCCAGTACATGGAGGGCTTCAACGACGAGCTGGAAGCCTTCAAG
NM_007065.3       ATTAAGACAGCCGATCGCCAGTACATGGAGGGCTTCAACGACGAGCTGGAAGCCTTCAAG
                  ************************************************************

HsCD00001267      GAGCGTGTGCGGGGCCGTGCCAAGCTGCGCATCGAGAAGGCCATGAAGGAGTACGAGGAG
NM_007065.3       GAGCGTGTGCGGGGCCGTGCCAAGCTGCGCATCGAGAAGGCCATGAAGGAGTACGAGGAG
                  ************************************************************

HsCD00001267      GAGGAGCGCAAGAAGCGGCTCGGCCCCGGCGGCCTGGACCCCGTCGAGGTCTACGAGTCC
NM_007065.3       GAGGAGCGCAAGAAGCGGCTCGGCCCCGGCGGCCTGGACCCCGTCGAGGTCTACGAGTCC
                  ************************************************************

HsCD00001267      CTCCCTGAGGAACTCCAGAAGTGCTTCGATGTGAAGGACGTGCAGATGCTGCAGGACGCC
NM_007065.3       CTCCCTGAGGAACTCCAGAAGTGCTTCGATGTGAAGGACGTGCAGATGCTGCAGGACGCC
                  ************************************************************

HsCD00001267      ATCAGCAAGATGGACCCCACCGACGCAAAGTACCACATGCAGCGCTGCATTGACTCTGGC
NM_007065.3       ATCAGCAAGATGGACCCCACCGACGCAAAGTACCACATGCAGCGCTGCATTGACTCTGGC
                  ************************************************************

HsCD00001267      CTCTGGGTCCCCAACTCTAAGGCCAGCGAGGCCAAGGAGGGAGAGGAGGCAGGTCCTGGG
NM_007065.3       CTCTGGGTCCCCAACTCTAAGGCCAGCGAGGCCAAGGAGGGAGAGGAGGCAGGTCCTGGG
                  ************************************************************

HsCD00001267      GACCCATTACTGGAAGCTGTTCCCAAGACGGGCGATGAGAAGGATGTCAGTGTGTTG
NM_007065.3       GACCCATTACTGGAAGCTGTTCCCAAGACGGGCGATGAGAAGGATGTCAGTGTGTGA
                  ******************************************************* .

Pathways

NCI : Integrin-linked kinase signaling
NCI : LKB1 signaling events
Reactome : Disease
Reactome : Signal Transduction
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by constitutively active EGFR
WikiPathway : TNF alpha Signaling Pathway

Clone

Cloning Information : 19411
HIP Master Clone ID : 33610
Original Clone ID : FLH019411.01L

Organism


TAX_ID : 9606
Species Specific ID: 11140

Genome

Chromosome : 19
Map Location : 19p13.2
Ensembl : ENSG00000105401

Reagents

Labome : CDC37-antibody