DNASU Plasmid Repository • 480.965.5697 | Email

SKP2 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SKP2
Gene Name:  S-phase kinase-associated protein 2, E3 ubiquitin protein ligase
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH117579.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00001278

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1275nts         Open reading frame : 1 to 1275
Reference Sequence Alignment

ATGCACAGGAAGCACCTCCAGGAGATTCCAGACCTGAGTAGCAACGTTGCCACCAGCTTC
ACGTGGGGATGGGATTCCAGCAAGACTTCTGAACTGCTGTCAGGCATGGGGGTCTCCGCC
CTGGAGAAAGAGGTGCCCGACAGTGAGAACATCCCCCAGGAACTGCTCTCAAACCTGGGC
CACCCGGAGAGCCCCCCACGGAAACGGCTGAAGAGCAAAGGGAGTGACAAAGACTTTGTG
ATTGTCCGCAGGCCTAAGCTAAATCGAGAGAACTTTCCAGGTGTTTCATGGGACTCCCTT
CCGGATGAGCTGCTCTTGGGAATCTTTTCCTGTCTGTGCCTCCCTGAGCTGCTAAAGGTC
TCTGGTGTTTGTAAGAGGTGGTATCGCCTAGCGTCTGATGAGTCTCTATGGCAGACCTTA
GACCTCACAGGTAAAAATCTGCACCCGGATGTGACTGGTCGGTTGCTGTCTCAAGGGGTG
ATTGCCTTCCGCTGCCCACGATCATTTATGGACCAACCATTGGCTGAACATTTCAGCCCT
TTTCGTGTACAGCACATGGACCTATCGAACTCAGTTATAGAAGTGTCCACCCTCCACGGC
ATACTGTCTCAGTGTTCCAAGTTGCAGAATCTAAGCCTGGAAGGCCTGCGGCTTTCGGAT
CCCATTGTCAATACTCTCGCAAAAAACTCAAATTTAGTGCGACTTAACCTTTCTGGGTGT
TCTGGATTCTCTGAATTTGCCCTGCAGACTTTGCTAAGCAGCTGTTCCAGACTGGATGAG
CTGAACCTCTCCTGGTGTTTTGATTTCACTGAAAAGCATGTACAGGTGGCTGTTGCGCAT
GTGTCAGAGACCATCACCCAGCTGAATCTTAGCGGCTACAGAAAGAATCTCCAGAAATCA
GATCTCTCTACTTTAGTTAGAAGATGCCCCAATCTTGTCCATCTAGACTTAAGTGATAGT
GTCATGCTAAAGAATGACTGCTTTCAGGAATTTTTCCAGCTCAACTACCTCCAACACCTA
TCACTCAGTCGGTGCTATGATATAATACCTGAAACTTTACTTGAACTTGGAGAAATTCCC
ACACTAAAAACACTACAAGTTTTTGGAATCGTGCCAGATGGTACCCTTCAACTGTTAAAG
GAAGCCCTTCCTCATCTACAGATTAATTGCTCCCATTTCACCACCATTGCCAGGCCAACT
ATTGGCAACAAAAAGAACCAGGAGATATGGGGCATCAAATGCCGACTGACACTGCAAAAG
CCCAGTTGTCTATAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1327
Start on reference sequence 53
Mutations:
None
Discrepancy:
a134t,E45V
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SKP2
Symbol Nomenclature : SKP2
SYNONYM : FBL1; FBXL1; FLB1; p45
Designation : CDK2/cyclin A-associated protein p45|F-box/LRR-repeat protein 1|S-phase kinase-associated protein 2|S-phase kinase-associated protein 2 (p45)|p45skp2
Full Nomenclature : S-phase kinase-associated protein 2, E3 ubiquitin protein ligase
GENEID : 6502
GI : 61358275
GenBank Accession : AY888598
HGNC : 10901
MIM : 601436
Vega : OTTHUMG00000131106
Target GenBank: AY029177

 

Reference Sequence Alignment

  

HsCD00001278      ATGCACAGGAAGCACCTCCAGGAGATTCCAGACCTGAGTAGCAACGTTGCCACCAGCTTC
NM_005983.3       ATGCACAGGAAGCACCTCCAGGAGATTCCAGACCTGAGTAGCAACGTTGCCACCAGCTTC
                  ************************************************************

HsCD00001278      ACGTGGGGATGGGATTCCAGCAAGACTTCTGAACTGCTGTCAGGCATGGGGGTCTCCGCC
NM_005983.3       ACGTGGGGATGGGATTCCAGCAAGACTTCTGAACTGCTGTCAGGCATGGGGGTCTCCGCC
                  ************************************************************

HsCD00001278      CTGGAGAAAGAGGTGCCCGACAGTGAGAACATCCCCCAGGAACTGCTCTCAAACCTGGGC
NM_005983.3       CTGGAGAAAGAGGAGCCCGACAGTGAGAACATCCCCCAGGAACTGCTCTCAAACCTGGGC
                  *************:**********************************************

HsCD00001278      CACCCGGAGAGCCCCCCACGGAAACGGCTGAAGAGCAAAGGGAGTGACAAAGACTTTGTG
NM_005983.3       CACCCGGAGAGCCCCCCACGGAAACGGCTGAAGAGCAAAGGGAGTGACAAAGACTTTGTG
                  ************************************************************

HsCD00001278      ATTGTCCGCAGGCCTAAGCTAAATCGAGAGAACTTTCCAGGTGTTTCATGGGACTCCCTT
NM_005983.3       ATTGTCCGCAGGCCTAAGCTAAATCGAGAGAACTTTCCAGGTGTTTCATGGGACTCCCTT
                  ************************************************************

HsCD00001278      CCGGATGAGCTGCTCTTGGGAATCTTTTCCTGTCTGTGCCTCCCTGAGCTGCTAAAGGTC
NM_005983.3       CCGGATGAGCTGCTCTTGGGAATCTTTTCCTGTCTGTGCCTCCCTGAGCTGCTAAAGGTC
                  ************************************************************

HsCD00001278      TCTGGTGTTTGTAAGAGGTGGTATCGCCTAGCGTCTGATGAGTCTCTATGGCAGACCTTA
NM_005983.3       TCTGGTGTTTGTAAGAGGTGGTATCGCCTAGCGTCTGATGAGTCTCTATGGCAGACCTTA
                  ************************************************************

HsCD00001278      GACCTCACAGGTAAAAATCTGCACCCGGATGTGACTGGTCGGTTGCTGTCTCAAGGGGTG
NM_005983.3       GACCTCACAGGTAAAAATCTGCACCCGGATGTGACTGGTCGGTTGCTGTCTCAAGGGGTG
                  ************************************************************

HsCD00001278      ATTGCCTTCCGCTGCCCACGATCATTTATGGACCAACCATTGGCTGAACATTTCAGCCCT
NM_005983.3       ATTGCCTTCCGCTGCCCACGATCATTTATGGACCAACCATTGGCTGAACATTTCAGCCCT
                  ************************************************************

HsCD00001278      TTTCGTGTACAGCACATGGACCTATCGAACTCAGTTATAGAAGTGTCCACCCTCCACGGC
NM_005983.3       TTTCGTGTACAGCACATGGACCTATCGAACTCAGTTATAGAAGTGTCCACCCTCCACGGC
                  ************************************************************

HsCD00001278      ATACTGTCTCAGTGTTCCAAGTTGCAGAATCTAAGCCTGGAAGGCCTGCGGCTTTCGGAT
NM_005983.3       ATACTGTCTCAGTGTTCCAAGTTGCAGAATCTAAGCCTGGAAGGCCTGCGGCTTTCGGAT
                  ************************************************************

HsCD00001278      CCCATTGTCAATACTCTCGCAAAAAACTCAAATTTAGTGCGACTTAACCTTTCTGGGTGT
NM_005983.3       CCCATTGTCAATACTCTCGCAAAAAACTCAAATTTAGTGCGACTTAACCTTTCTGGGTGT
                  ************************************************************

HsCD00001278      TCTGGATTCTCTGAATTTGCCCTGCAGACTTTGCTAAGCAGCTGTTCCAGACTGGATGAG
NM_005983.3       TCTGGATTCTCTGAATTTGCCCTGCAGACTTTGCTAAGCAGCTGTTCCAGACTGGATGAG
                  ************************************************************

HsCD00001278      CTGAACCTCTCCTGGTGTTTTGATTTCACTGAAAAGCATGTACAGGTGGCTGTTGCGCAT
NM_005983.3       CTGAACCTCTCCTGGTGTTTTGATTTCACTGAAAAGCATGTACAGGTGGCTGTTGCGCAT
                  ************************************************************

HsCD00001278      GTGTCAGAGACCATCACCCAGCTGAATCTTAGCGGCTACAGAAAGAATCTCCAGAAATCA
NM_005983.3       GTGTCAGAGACCATCACCCAGCTGAATCTTAGCGGCTACAGAAAGAATCTCCAGAAATCA
                  ************************************************************

HsCD00001278      GATCTCTCTACTTTAGTTAGAAGATGCCCCAATCTTGTCCATCTAGACTTAAGTGATAGT
NM_005983.3       GATCTCTCTACTTTAGTTAGAAGATGCCCCAATCTTGTCCATCTAGACTTAAGTGATAGT
                  ************************************************************

HsCD00001278      GTCATGCTAAAGAATGACTGCTTTCAGGAATTTTTCCAGCTCAACTACCTCCAACACCTA
NM_005983.3       GTCATGCTAAAGAATGACTGCTTTCAGGAATTTTTCCAGCTCAACTACCTCCAACACCTA
                  ************************************************************

HsCD00001278      TCACTCAGTCGGTGCTATGATATAATACCTGAAACTTTACTTGAACTTGGAGAAATTCCC
NM_005983.3       TCACTCAGTCGGTGCTATGATATAATACCTGAAACTTTACTTGAACTTGGAGAAATTCCC
                  ************************************************************

HsCD00001278      ACACTAAAAACACTACAAGTTTTTGGAATCGTGCCAGATGGTACCCTTCAACTGTTAAAG
NM_005983.3       ACACTAAAAACACTACAAGTTTTTGGAATCGTGCCAGATGGTACCCTTCAACTGTTAAAG
                  ************************************************************

HsCD00001278      GAAGCCCTTCCTCATCTACAGATTAATTGCTCCCATTTCACCACCATTGCCAGGCCAACT
NM_005983.3       GAAGCCCTTCCTCATCTACAGATTAATTGCTCCCATTTCACCACCATTGCCAGGCCAACT
                  ************************************************************

HsCD00001278      ATTGGCAACAAAAAGAACCAGGAGATATGGGGCATCAAATGCCGACTGACACTGCAAAAG
NM_005983.3       ATTGGCAACAAAAAGAACCAGGAGATATGGGGCATCAAATGCCGACTGACACTGCAAAAG
                  ************************************************************

HsCD00001278      CCCAGTTGTCTATAG
NM_005983.3       CCCAGTTGTCTATGA
                  *************..

Pathways

NCI : C-MYC pathway
NCI : FOXM1 transcription factor network
NCI : FoxO family signaling
NCI : Notch signaling pathway
NCI : Regulation of retinoblastoma protein
NCI : p53 pathway
Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : APC/C:Cdh1 mediated degradation of Cdc20 and other APC/C:Cdh1 targeted proteins in late mitosis/early G1
Reactome : Adaptive Immune System
Reactome : Antigen processing: Ubiquitination & Proteasome degradation
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Cyclin A:Cdk2-associated events at S phase entry
Reactome : Cyclin D associated events in G1
Reactome : Cyclin E associated events during G1/S transition
Reactome : G1 Phase
Reactome : G1/S Transition
Reactome : Immune System
Reactome : Mitotic G1-G1/S phases
Reactome : Regulation of mitotic cell cycle
Reactome : S Phase
Reactome : SCF(Skp2)-mediated degradation of p27/p21
WikiPathway : Cell cycle

Protein

SMART domain : FBOX : A Receptor for Ubiquitination Targets
UniProt : Q13309
HPRD : 03256

Clone

Cloning Information : 117579
HIP Master Clone ID : 93425
Original Clone ID : FLH117579.01X

Organism


TAX_ID : 9606
Species Specific ID: 6502

Genome

Chromosome : 5
Map Location : 5p13
Ensembl : ENSG00000145604

Reagents

Labome : Skp2-antibody