DNASU Plasmid Repository • 480.965.5697 | Email

IFNA17 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  IFNA17
Gene Name:  interferon, alpha 17
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH116455.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00000013

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 570nts         Open reading frame : 1 to 570
Reference Sequence Alignment

ATGGCCCTGTCCTTTTCTTTACTGATGGCCGTGCTGGTGCTCAGCTACAAATCCATCTGT
TCTCTAGGCTGTGATCTGCCTCAGACCCACAGCCTGGGTAATAGGAGGGCCTTGATACTC
CTGGCACAAATGGGAAGAATCTCTCCTTTCTCCTGCCTGAAGGACAGACATGACTTTGGA
CTTCCCCAGGAGGAGTTTGATGGCAACCAGTTCCAGAAGACTCAAGCCATCTCTGTCCTC
CATGAGATGATCCAGCAGACCTTCAATCTCTTCAGCACAGAGGACTCATCTGCTGCTTGG
GAACAGAGCCTCCTAGAAAAATTTTCCACTGAACTTTACCAGCAACTGAATAACCTGGAA
GCATGTGTGATACAGGAGGTTGGGATGGAAGAGACTCCCCTGATGAATGAGGACTCCATC
CTGGCTGTGAGGAAATACTTCCAAAGAATCACTCTTTATCTAACAGAGAAGAAATACAGC
CCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCTCTCTCTTTTTCAACAAAC
TTGCAAAAAATATTAAGGAGGAAGGATTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 619
Start on reference sequence 50
Mutations:
None
Discrepancy:
c522t
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : IFNA17
Symbol Nomenclature : IFNA17
SYNONYM : IFN-alphaI; IFNA; INFA; LEIF2C1
Designation : IFN-alpha-17|interferon alpha-17|interferon alpha-88|interferon alpha-I'|interferon alpha-T|interferon alpha-WA|leIF I
Full Nomenclature : interferon, alpha 17
GENEID : 3451
Locus Tag : RP11-380P16.10-001
GI : 61354773
GenBank Accession : AY888110
HGNC : 5422
MIM : 147583
Vega : OTTHUMG00000019667
Target GenBank: NM_021268

 

Reference Sequence Alignment

  

HsCD00000013      ATGGCCCTGTCCTTTTCTTTACTGATGGCCGTGCTGGTGCTCAGCTACAAATCCATCTGT
NM_002175.2       ATGGCCCTGTCCTTTTCTTTACTGATGGCCGTGCTGGTGCTCAGCTACAAATCCATCTGT
NM_021068.2       ATGGCCCTGTCCTTTTCTTTACTGATGGCCGTGCTGGTGCTCAGCTACAAATCCATCTGT
NM_021057.2       ATGGCCCGGTCCTTTTCTTTACTGATGGTCGTGCTGGTACTCAGCTACAAATCCATCTGC
NM_002171.2       ATGGCCCTGTCCTTTTCTTTACTTATGGCCGTGCTGGTGCTCAGCTACAAATCCATCTGT
NM_021268.2       ATGGCCCTGTCCTTTTCTTTACTGATGGCCGTGCTGGTGCTCAGCTACAAATCCATCTGT
                  ******* *************** **** *********.******************** 

HsCD00000013      TCTCTAGGCTGTGATCTGCCTCAGACCCACAGCCTGGGTAATAGGAGGGCCTTGATACTC
NM_002175.2       TCTCTGGGCTGTGATCTGCCTCAGACCCACAGCCTGGGTAATAGGAGGGCCTTGATACTC
NM_021068.2       TCTCTGGGCTGTGATCTGCCTCAGACCCACAGCCTGGGTAATAGGAGGGCCTTGATACTC
NM_021057.2       TCTCTGGGCTGTGATCTGCCTCAGACCCACAGCCTGCGTAATAGGAGGGCCTTGATACTC
NM_002171.2       TCTCTAGGCTGTGATCTGCCTCAGACCCACAGCCTGGGTAATAGGAGGGCCTTGATACTC
NM_021268.2       TCTCTAGGCTGTGATCTGCCTCAGACCCACAGCCTGGGTAATAGGAGGGCCTTGATACTC
                  *****.****************************** ***********************

HsCD00000013      CTGGCACAAATGGGAAGAATCTCTCCTTTCTCCTGCCTGAAGGACAGACATGACTTTGGA
NM_002175.2       CTGGCACAAATGGGAAGAATCTCTCCTTTCTCCTGCCTGAAGGACAGACATGACTTTGGA
NM_021068.2       CTGGCACAAATGGGAAGAATCTCTCATTTCTCCTGCCTGAAGGACAGACATGATTTCGGA
NM_021057.2       CTGGCACAAATGGGAAGAATCTCTCCTTTCTCCTGCTTGAAGGACAGACATGAATTCAGA
NM_002171.2       CTGGGACAAATGGGAAGAATCTCTCCTTTCTCCTGCCTGAAGGACAGACATGATTTCCGA
NM_021268.2       CTGGCACAAATGGGAAGAATCTCTCCTTTCTCCTGCCTGAAGGACAGACATGACTTTGGA
                  **** ********************.********** **************** **  **

HsCD00000013      CTTCCCCAGGAGGAGTTTGATGGCAACCAGTTCCAGAAGACTCAAGCCATCTCTGTCCTC
NM_002175.2       TTCCCCCAGGAGGAGTTTGATGGCAACCAGTTCCAGAAGGCTCAAGCCATCTCTGTCCTC
NM_021068.2       TTCCCCGAGGAGGAGTTTGATGGCCACCAGTTCCAGAAGGCTCAAGCCATCTCTGTCCTC
NM_021057.2       TTCCCAGAGGAGGAGTTTGATGGCCACCAGTTCCAGAAGACTCAAGCCATCTCTGTCCTC
NM_002171.2       ATCCCCCAGGAGGAGTTTGATGGCAACCAGTTCCAGAAGGCTCAAGCCATCTCTGTCCTC
NM_021268.2       CTTCCCCAGGAGGAGTTTGATGGCAACCAGTTCCAGAAGACTCAAGCCATCTCTGTCCTC
                   * **. *****************.**************.********************

HsCD00000013      CATGAGATGATCCAGCAGACCTTCAATCTCTTCAGCACAGAGGACTCATCTGCTGCTTGG
NM_002175.2       CATGAGATGATCCAGCAGACCTTCAATCTCTTCAGCACAAAGGACTCATCTGCTACTTGG
NM_021068.2       CATGAGATGATCCAGCAGACCTTCAATCTCTTCAGCACAGAGGACTCATCTGCTGCTTGG
NM_021057.2       CATGAGATGATCCAGCAGACCTTCAATCTCTTCAGCACAGAGGACTCATCTGCTGCTTGG
NM_002171.2       CATGAGATGATCCAGCAGACCTTCAATCTCTTCAGCACAGAGGACTCATCTGCTGCTTGG
NM_021268.2       CATGAGATGATCCAGCAGACCTTCAATCTCTTCAGCACAGAGGACTCATCTGCTGCTTGG
                  ***************************************.**************.*****

HsCD00000013      GAACAGAGCCTCCTAGAAAAATTTTCCACTGAACTTTACCAGCAACTGAATAACCTGGAA
NM_002175.2       GAACAGAGCCTCCTAGAAAAATTTTCCACTGAACTTAACCAGCAGCTGAATGACCTGGAA
NM_021068.2       GAACAGAGCCTCCTAGAAAAATTTTCCACTGAACTTTACCAGCAACTGAATGACCTGGAA
NM_021057.2       GAACAGAGCCTCCTAGAAAAATTTTCCACTGAACTTTACCAGCAACTGAATGACCTGGAA
NM_002171.2       GAACAGAGCCTCCTAGAAAAATTTTCCACTGAACTTTACCAGCAACTGAATGACCTGGAA
NM_021268.2       GAACAGAGCCTCCTAGAAAAATTTTCCACTGAACTTTACCAGCAACTGAATAACCTGGAA
                  ************************************:*******.******.********

HsCD00000013      GCATGTGTGATACAGGAGGTTGGGATGGAAGAGACTCCCCTGATGAATGAGGACTCCATC
NM_002175.2       GCCTGCGTGATACAGGAGGTTGGGGTGGAAGAGACTCCCCTGATGAATGTGGACTCCATC
NM_021068.2       GCATGTGTGATACAGGAGGTTGGGGTGGAAGAGACTCCCCTGATGAATGAGGACTCCATC
NM_021057.2       GCATGTGTGATACAGGAGGTTGGGGTGGAAGAGACTCCCCTGATGAATGAGGACTTCATC
NM_002171.2       GCATGTGTGATACAGGAGGTTGGGGTGGAAGAGACTCCCCTGATGAATGAGGACTCCATC
NM_021268.2       GCATGTGTGATACAGGAGGTTGGGATGGAAGAGACTCCCCTGATGAATGAGGACTCCATC
                  **.** ******************.************************:***** ****

HsCD00000013      CTGGCTGTGAGGAAATACTTCCAAAGAATCACTCTTTATCTAACAGAGAAGAAATACAGC
NM_002175.2       CTGGCTGTGAAGAAATACTTCCAAAGAATCACTCTTTATCTGACAGAGAAGAAATACAGC
NM_021068.2       CTGGCTGTGAGGAAATACTTCCAAAGAATCACTCTTTATCTAACAGAGAAGAAATACAGC
NM_021057.2       CTGGCTGTGAGGAAATACTTCCAAAGAATCACTCTTTATCTAATGGAGAAGAAATACAGC
NM_002171.2       CTGGCTGTGAGGAAATACTTCCAAAGAATCACTCTTTATCTAATAGAGAGGAAATACAGC
NM_021268.2       CTGGCTGTGAGGAAATACTTCCAAAGAATCACTCTTTATCTAACAGAGAAGAAATACAGC
                  **********.******************************.* .****.**********

HsCD00000013      CCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCTCTCTCTTTTTCAACAAAC
NM_002175.2       CCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCCTTCTCTTTATCAAAAATT
NM_021068.2       CCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCCCTCTCGTTTTCAACAAAC
NM_021057.2       CCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCCTTCTCTTTTTCAACAAAC
NM_002171.2       CCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCCCTCTCGTTTTCAACAAAC
NM_021268.2       CCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCTCTCTCTTTTTCAACAAAC
                  *****************************************  **** **:****.**: 

HsCD00000013      TTGCAAAAAATATTAAGGAGGAAGGATTAG
NM_002175.2       TTTCAAGAAAGATTAAGGAGGAAGGAATGA
NM_021068.2       TTGCAAAAAAGATTAAGGAGGAAGGATTGA
NM_021057.2       TTGAAAAAAGGATTAAGGAGGAAGGATTGA
NM_002171.2       TTGCAAAAAAGATTAAGGAGGAAGGATTGA
NM_021268.2       TTGCAAAAAATATTAAGGAGGAAGGATTGA
                  ** .**.**. ***************:*..

Pathways

NCI : Downstream signaling in naïve CD8+ T cells
Reactome : Cytokine Signaling in Immune system
Reactome : Factors involved in megakaryocyte development and platelet production
Reactome : Hemostasis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interferon Signaling
Reactome : Interferon alpha/beta signaling
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : Regulation of IFNA signaling
Reactome : TRAF6 mediated IRF7 activation
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Toll-like receptor signaling pathway

Protein

SMART domain : IFabd : Interferon alpha, beta and delta.
UniProt : P01571
HPRD : 00967

Clone

Cloning Information : 116455
HIP Master Clone ID : 92301
Original Clone ID : FLH116455.01X

Organism


TAX_ID : 9606
Species Specific ID: 3451

Genome

Chromosome : 9
Map Location : 9p22
Ensembl : ENSG00000234829

Reagents

Labome : IFNA17-antibody