DNASU Plasmid Repository • 480.965.5697 | Email

TNF (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TNF
Gene Name:  tumor necrosis factor
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH053668.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00001319

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 702nts         Open reading frame : 1 to 702
Reference Sequence Alignment

ATGAGCACTGAAAGCATGATCCGGGACGTGGAGCTGGCCGAGGAGGCGCTCCCCAAGAAG
ACAGGGGGGCCCCAGGGCTCCAGGCGGTGCTTGTTCCTCAGCCTCTTCTCCTTCCTGATC
GTGGCAGGCGCCACCACGCTCTTCTGCCTGCTGCACTTTGGAGTGATCGGCCCCCAGAGG
GAAGAGTTCCCCAGGGACCTCTCTCTAATCAGCCCTCTGGCCCAGGCAGTCAGATCATCT
TCTCGAACCCCGAGTGACAAGCCTGTAGCCCATGTTGTAGCAAACCCTCAAGCTGAGGGG
CAGCTCCAGTGGCTGAACCGCCGGGCCAATGCCCTCCTGGCCAATGGCGTGGAGCTGAGA
GATAACCAGCTGGTGGTGCCATCAGAGGGCCTGTACCTCATCTACTCCCAGGTCCTCTTC
AAGGGCCAAGGCTGCCCCTCCACCCATGTGCTCCTCACCCACACCATCAGCCGCATCGCC
GTCTCCTACCAGACCAAGGTCAACCTCCTCTCTGCCATCAAGAGCCCCTGCCAGAGGGAG
ACCCCAGAGGGGGCTGAGGCCAAGCCCTGGTATGAGCCCATCTATCTGGGAGGGGTCTTC
CAGCTGGAGAAGGGTGACCGACTCAGCGCTGAGATCAATCGGCCCGACTATCTCGACTTT
GCCGAGTCTGGGCAGGTCTACTTTGGGATCATTGCCCTGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 787
Start on reference sequence 86
Mutations:
None
Discrepancy:
c188t,S63F
                                

5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TNF
Symbol Nomenclature : TNF
SYNONYM : DIF; TNF-alpha; TNFA; TNFSF2
Designation : APC1 protein|TNF, macrophage-derived|TNF, monocyte-derived|TNF-a|cachectin|tumor necrosis factor ligand superfamily member 2|tumor necrosis factor-alpha
Full Nomenclature : tumor necrosis factor
GENEID : 7124
Locus Tag : DADB-70P7.1
GI : 60828079
GenBank Accession : AY893790
HGNC : 11892
MIM : 191160
Vega : OTTHUMG00000031194
Target GenBank: NM_000594

 

Reference Sequence Alignment

  

HsCD00001319      ATGAGCACTGAAAGCATGATCCGGGACGTGGAGCTGGCCGAGGAGGCGCTCCCCAAGAAG
NM_000594.3       ATGAGCACTGAAAGCATGATCCGGGACGTGGAGCTGGCCGAGGAGGCGCTCCCCAAGAAG
                  ************************************************************

HsCD00001319      ACAGGGGGGCCCCAGGGCTCCAGGCGGTGCTTGTTCCTCAGCCTCTTCTCCTTCCTGATC
NM_000594.3       ACAGGGGGGCCCCAGGGCTCCAGGCGGTGCTTGTTCCTCAGCCTCTTCTCCTTCCTGATC
                  ************************************************************

HsCD00001319      GTGGCAGGCGCCACCACGCTCTTCTGCCTGCTGCACTTTGGAGTGATCGGCCCCCAGAGG
NM_000594.3       GTGGCAGGCGCCACCACGCTCTTCTGCCTGCTGCACTTTGGAGTGATCGGCCCCCAGAGG
                  ************************************************************

HsCD00001319      GAAGAGTTCCCCAGGGACCTCTCTCTAATCAGCCCTCTGGCCCAGGCAGTCAGATCATCT
NM_000594.3       GAAGAGTTCCCCAGGGACCTCTCTCTAATCAGCCCTCTGGCCCAGGCAGTCAGATCATCT
                  ************************************************************

HsCD00001319      TCTCGAACCCCGAGTGACAAGCCTGTAGCCCATGTTGTAGCAAACCCTCAAGCTGAGGGG
NM_000594.3       TCTCGAACCCCGAGTGACAAGCCTGTAGCCCATGTTGTAGCAAACCCTCAAGCTGAGGGG
                  ************************************************************

HsCD00001319      CAGCTCCAGTGGCTGAACCGCCGGGCCAATGCCCTCCTGGCCAATGGCGTGGAGCTGAGA
NM_000594.3       CAGCTCCAGTGGCTGAACCGCCGGGCCAATGCCCTCCTGGCCAATGGCGTGGAGCTGAGA
                  ************************************************************

HsCD00001319      GATAACCAGCTGGTGGTGCCATCAGAGGGCCTGTACCTCATCTACTCCCAGGTCCTCTTC
NM_000594.3       GATAACCAGCTGGTGGTGCCATCAGAGGGCCTGTACCTCATCTACTCCCAGGTCCTCTTC
                  ************************************************************

HsCD00001319      AAGGGCCAAGGCTGCCCCTCCACCCATGTGCTCCTCACCCACACCATCAGCCGCATCGCC
NM_000594.3       AAGGGCCAAGGCTGCCCCTCCACCCATGTGCTCCTCACCCACACCATCAGCCGCATCGCC
                  ************************************************************

HsCD00001319      GTCTCCTACCAGACCAAGGTCAACCTCCTCTCTGCCATCAAGAGCCCCTGCCAGAGGGAG
NM_000594.3       GTCTCCTACCAGACCAAGGTCAACCTCCTCTCTGCCATCAAGAGCCCCTGCCAGAGGGAG
                  ************************************************************

HsCD00001319      ACCCCAGAGGGGGCTGAGGCCAAGCCCTGGTATGAGCCCATCTATCTGGGAGGGGTCTTC
NM_000594.3       ACCCCAGAGGGGGCTGAGGCCAAGCCCTGGTATGAGCCCATCTATCTGGGAGGGGTCTTC
                  ************************************************************

HsCD00001319      CAGCTGGAGAAGGGTGACCGACTCAGCGCTGAGATCAATCGGCCCGACTATCTCGACTTT
NM_000594.3       CAGCTGGAGAAGGGTGACCGACTCAGCGCTGAGATCAATCGGCCCGACTATCTCGACTTT
                  ************************************************************

HsCD00001319      GCCGAGTCTGGGCAGGTCTACTTTGGGATCATTGCCCTGTTG
NM_000594.3       GCCGAGTCTGGGCAGGTCTACTTTGGGATCATTGCCCTGTGA
                  **************************************** .

Pathways

NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : Calcineurin-regulated NFAT-dependent transcription in lymphocytes
NCI : Canonical NF-kappaB pathway
NCI : Caspase Cascade in Apoptosis
NCI : Cellular roles of Anthrax toxin
NCI : Ceramide signaling pathway
NCI : Downstream signaling in naïve CD8+ T cells
NCI : HIV-1 Nef: Negative effector of Fas and TNF-alpha
NCI : IL23-mediated signaling events
NCI : IL27-mediated signaling events
NCI : RXR and RAR heterodimerization with other nuclear receptor
NCI : Signaling events mediated by HDAC Class I
NCI : TNF receptor signaling pathway
NCI : amb2 Integrin signaling
Panther : Apoptosis signaling pathway
Panther : Wnt signaling pathway
Reactome : Apoptosis
Reactome : Death Receptor Signalling
Reactome : Developmental Biology
Reactome : Extrinsic Pathway for Apoptosis
Reactome : TNF signaling
Reactome : Transcriptional regulation of white adipocyte differentiation
WikiPathway : Adipogenesis
WikiPathway : Alzheimers Disease
WikiPathway : Apoptosis
WikiPathway : Cytokines and Inflammatory Response
WikiPathway : EBV LMP1 signaling
WikiPathway : FAS pathway and Stress induction of HSP regulation
WikiPathway : Folate Metabolism
WikiPathway : MAPK signaling pathway
WikiPathway : Matrix Metalloproteinases
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Monoamine Transport
WikiPathway : Notch Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : SIDS Susceptibility Pathways
WikiPathway : Selenium Pathway
WikiPathway : TGF Beta Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway
WikiPathway : Type II diabetes mellitus
WikiPathway : Vitamin B12 Metabolism

Protein

SMART domain : TNF : Tumour necrosis factor family.
UniProt : P01375
UniProt : C1K3N5
UniProt : Q5STB3
HPRD : 01855

Clone

Cloning Information : 53668
HIP Master Clone ID : 9929
Original Clone ID : FLH053668.01L

Organism


TAX_ID : 9606
Species Specific ID: 7124

Genome

Chromosome : 6
Map Location : 6p21.3
Ensembl : ENSG00000232810

Reagents

Labome : TNF-alpha-antibody