DNASU Plasmid Repository • 480.965.5697 | Email

WNT5A (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  WNT5A
Gene Name:  wingless-type MMTV integration site family, member 5A
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH054237.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00001345

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1098nts         Open reading frame : 1 to 1098
Reference Sequence Alignment

ATGGCTGGAAGTGCAATGTCTTCCAAGTTCTTCCTAGTGGCTTTGGCCATATTTTTCTCC
TTCGCCCAGGTTGTAATTGAAGCCAATTCTTGGTGGTCGCTAGGTATGAATAACCCTGTT
CAGATGTCAGAAGTATATATTATAGGAGCACAGCCTCTCTGCAGCCAACTGGCAGGACTT
TCTCAAGGACAGAAGAAACTGTGCCACTTGTATCAGGACCACATGCAGTACATCGGAGAA
GGCGCGAAGACAGGCATCAAAGAATGCCAGTATCAATTCCGACATCGAAGGTGGAACTGC
AGCACTGTGGATAACACCTCTGTTTTTGGCAGGGTGATGCAGATAGGCAGCCGCGAGACG
GCCTTCACATACGCGGTGAGCGCAGCAGGGGTGGTGAACGCCATGAGCCGGGCGTGCCGC
GAGGGCGAGCTGTCCACCTGCGGCTGCAGCCGCGCCGCGCGCCCCAAGGACCTGCCGCGG
GACTGGCTCTGGGGCGGCTGCGGCGACAACATCGACTATGGCTACCGCTTTGCCAAGGAG
TTCGTGGACGCCCGCGAGCGGGAGCGCATCCACGCCAAGGGCTCCTACGAGAGTGCTCGC
ATCCTCATGAACCTGCACAACAACGAGGCCGGCCGCAGGACGGTGTACAACCTGGCTGAT
GTGGCCTGCAAGTGCCATGGGGTGTCCGGCTCATGTAGCCTGAAGACATGCTGGCTGCAG
CTGGCAGACTTCCGCAAGGTGGGTGATGCCCTGAAGGAGAAGTACGACAGCGCGGCGGCC
ATGCGGCTCAACAGCCGGGGCAAGTTGGTACAGGTCAACAGCCGCTTCAACTCGCCCACC
ACACAAGACCTGGTCTACATCGACCCCAGCCCTGACTACTGCGTGCGCAATGAGAGCACC
GGCTCGCTGGGCACGCAGGGCCGCCTGTGCAACAAGACGTCGGAGGGCATGGATGGCTGC
GAGCTCATGTGCTGCGGCCGTGGCTACGACCAGTTCAAGACCGTGCAGACGGAGCGCTGC
CACTGCAAGTTCCACTGGTGCTGCTACGTCAAGTGCAAGAAGTGCACGGAGATCGTGGAC
CAGTTTGTGTGCAAGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1581
Start on reference sequence 484
Mutations:
None
Discrepancy:
c289a; c375g; g984c
                                

5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : WNT5A
Symbol Nomenclature : WNT5A
SYNONYM : hWNT5A
Designation : WNT-5A protein|protein Wnt-5a
Full Nomenclature : wingless-type MMTV integration site family, member 5A
GENEID : 7474
GI : 60828222
GenBank Accession : AY893797
HGNC : 12784
MIM : 164975
Vega : OTTHUMG00000158361
Target GenBank: NM_003392

 

Reference Sequence Alignment

  

HsCD00001345        ---------------------------------------------ATGGCTGGAAGTGCA
NM_003392.4         ATGAAGAAGTCCATTGGAATATTAAGCCCAGGAGTTGCTTTGGGGATGGCTGGAAGTGCA
NM_001256105.1      ---------------------------------------------ATGGCTGGAAGTGCA
                                                                 ***************

HsCD00001345        ATGTCTTCCAAGTTCTTCCTAGTGGCTTTGGCCATATTTTTCTCCTTCGCCCAGGTTGTA
NM_003392.4         ATGTCTTCCAAGTTCTTCCTAGTGGCTTTGGCCATATTTTTCTCCTTCGCCCAGGTTGTA
NM_001256105.1      ATGTCTTCCAAGTTCTTCCTAGTGGCTTTGGCCATATTTTTCTCCTTCGCCCAGGTTGTA
                    ************************************************************

HsCD00001345        ATTGAAGCCAATTCTTGGTGGTCGCTAGGTATGAATAACCCTGTTCAGATGTCAGAAGTA
NM_003392.4         ATTGAAGCCAATTCTTGGTGGTCGCTAGGTATGAATAACCCTGTTCAGATGTCAGAAGTA
NM_001256105.1      ATTGAAGCCAATTCTTGGTGGTCGCTAGGTATGAATAACCCTGTTCAGATGTCAGAAGTA
                    ************************************************************

HsCD00001345        TATATTATAGGAGCACAGCCTCTCTGCAGCCAACTGGCAGGACTTTCTCAAGGACAGAAG
NM_003392.4         TATATTATAGGAGCACAGCCTCTCTGCAGCCAACTGGCAGGACTTTCTCAAGGACAGAAG
NM_001256105.1      TATATTATAGGAGCACAGCCTCTCTGCAGCCAACTGGCAGGACTTTCTCAAGGACAGAAG
                    ************************************************************

HsCD00001345        AAACTGTGCCACTTGTATCAGGACCACATGCAGTACATCGGAGAAGGCGCGAAGACAGGC
NM_003392.4         AAACTGTGCCACTTGTATCAGGACCACATGCAGTACATCGGAGAAGGCGCGAAGACAGGC
NM_001256105.1      AAACTGTGCCACTTGTATCAGGACCACATGCAGTACATCGGAGAAGGCGCGAAGACAGGC
                    ************************************************************

HsCD00001345        ATCAAAGAATGCCAGTATCAATTCCGACATCGAAGGTGGAACTGCAGCACTGTGGATAAC
NM_003392.4         ATCAAAGAATGCCAGTATCAATTCCGACATCGAAGGTGGAACTGCAGCACTGTGGATAAC
NM_001256105.1      ATCAAAGAATGCCAGTATCAATTCCGACATCGAAGGTGGAACTGCAGCACTGTGGATAAC
                    ************************************************************

HsCD00001345        ACCTCTGTTTTTGGCAGGGTGATGCAGATAGGCAGCCGCGAGACGGCCTTCACATACGCG
NM_003392.4         ACCTCTGTTTTTGGCAGGGTGATGCAGATAGGCAGCCGCGAGACGGCCTTCACATACGCG
NM_001256105.1      ACCTCTGTTTTTGGCAGGGTGATGCAGATAGGCAGCCGCGAGACGGCCTTCACATACGCG
                    ************************************************************

HsCD00001345        GTGAGCGCAGCAGGGGTGGTGAACGCCATGAGCCGGGCGTGCCGCGAGGGCGAGCTGTCC
NM_003392.4         GTGAGCGCAGCAGGGGTGGTGAACGCCATGAGCCGGGCGTGCCGCGAGGGCGAGCTGTCC
NM_001256105.1      GTGAGCGCAGCAGGGGTGGTGAACGCCATGAGCCGGGCGTGCCGCGAGGGCGAGCTGTCC
                    ************************************************************

HsCD00001345        ACCTGCGGCTGCAGCCGCGCCGCGCGCCCCAAGGACCTGCCGCGGGACTGGCTCTGGGGC
NM_003392.4         ACCTGCGGCTGCAGCCGCGCCGCGCGCCCCAAGGACCTGCCGCGGGACTGGCTCTGGGGC
NM_001256105.1      ACCTGCGGCTGCAGCCGCGCCGCGCGCCCCAAGGACCTGCCGCGGGACTGGCTCTGGGGC
                    ************************************************************

HsCD00001345        GGCTGCGGCGACAACATCGACTATGGCTACCGCTTTGCCAAGGAGTTCGTGGACGCCCGC
NM_003392.4         GGCTGCGGCGACAACATCGACTATGGCTACCGCTTTGCCAAGGAGTTCGTGGACGCCCGC
NM_001256105.1      GGCTGCGGCGACAACATCGACTATGGCTACCGCTTTGCCAAGGAGTTCGTGGACGCCCGC
                    ************************************************************

HsCD00001345        GAGCGGGAGCGCATCCACGCCAAGGGCTCCTACGAGAGTGCTCGCATCCTCATGAACCTG
NM_003392.4         GAGCGGGAGCGCATCCACGCCAAGGGCTCCTACGAGAGTGCTCGCATCCTCATGAACCTG
NM_001256105.1      GAGCGGGAGCGCATCCACGCCAAGGGCTCCTACGAGAGTGCTCGCATCCTCATGAACCTG
                    ************************************************************

HsCD00001345        CACAACAACGAGGCCGGCCGCAGGACGGTGTACAACCTGGCTGATGTGGCCTGCAAGTGC
NM_003392.4         CACAACAACGAGGCCGGCCGCAGGACGGTGTACAACCTGGCTGATGTGGCCTGCAAGTGC
NM_001256105.1      CACAACAACGAGGCCGGCCGCAGGACGGTGTACAACCTGGCTGATGTGGCCTGCAAGTGC
                    ************************************************************

HsCD00001345        CATGGGGTGTCCGGCTCATGTAGCCTGAAGACATGCTGGCTGCAGCTGGCAGACTTCCGC
NM_003392.4         CATGGGGTGTCCGGCTCATGTAGCCTGAAGACATGCTGGCTGCAGCTGGCAGACTTCCGC
NM_001256105.1      CATGGGGTGTCCGGCTCATGTAGCCTGAAGACATGCTGGCTGCAGCTGGCAGACTTCCGC
                    ************************************************************

HsCD00001345        AAGGTGGGTGATGCCCTGAAGGAGAAGTACGACAGCGCGGCGGCCATGCGGCTCAACAGC
NM_003392.4         AAGGTGGGTGATGCCCTGAAGGAGAAGTACGACAGCGCGGCGGCCATGCGGCTCAACAGC
NM_001256105.1      AAGGTGGGTGATGCCCTGAAGGAGAAGTACGACAGCGCGGCGGCCATGCGGCTCAACAGC
                    ************************************************************

HsCD00001345        CGGGGCAAGTTGGTACAGGTCAACAGCCGCTTCAACTCGCCCACCACACAAGACCTGGTC
NM_003392.4         CGGGGCAAGTTGGTACAGGTCAACAGCCGCTTCAACTCGCCCACCACACAAGACCTGGTC
NM_001256105.1      CGGGGCAAGTTGGTACAGGTCAACAGCCGCTTCAACTCGCCCACCACACAAGACCTGGTC
                    ************************************************************

HsCD00001345        TACATCGACCCCAGCCCTGACTACTGCGTGCGCAATGAGAGCACCGGCTCGCTGGGCACG
NM_003392.4         TACATCGACCCCAGCCCTGACTACTGCGTGCGCAATGAGAGCACCGGCTCGCTGGGCACG
NM_001256105.1      TACATCGACCCCAGCCCTGACTACTGCGTGCGCAATGAGAGCACCGGCTCGCTGGGCACG
                    ************************************************************

HsCD00001345        CAGGGCCGCCTGTGCAACAAGACGTCGGAGGGCATGGATGGCTGCGAGCTCATGTGCTGC
NM_003392.4         CAGGGCCGCCTGTGCAACAAGACGTCGGAGGGCATGGATGGCTGCGAGCTCATGTGCTGC
NM_001256105.1      CAGGGCCGCCTGTGCAACAAGACGTCGGAGGGCATGGATGGCTGCGAGCTCATGTGCTGC
                    ************************************************************

HsCD00001345        GGCCGTGGCTACGACCAGTTCAAGACCGTGCAGACGGAGCGCTGCCACTGCAAGTTCCAC
NM_003392.4         GGCCGTGGCTACGACCAGTTCAAGACCGTGCAGACGGAGCGCTGCCACTGCAAGTTCCAC
NM_001256105.1      GGCCGTGGCTACGACCAGTTCAAGACCGTGCAGACGGAGCGCTGCCACTGCAAGTTCCAC
                    ************************************************************

HsCD00001345        TGGTGCTGCTACGTCAAGTGCAAGAAGTGCACGGAGATCGTGGACCAGTTTGTGTGCAAG
NM_003392.4         TGGTGCTGCTACGTCAAGTGCAAGAAGTGCACGGAGATCGTGGACCAGTTTGTGTGCAAG
NM_001256105.1      TGGTGCTGCTACGTCAAGTGCAAGAAGTGCACGGAGATCGTGGACCAGTTTGTGTGCAAG
                    ************************************************************

HsCD00001345        TTG
NM_003392.4         TAG
NM_001256105.1      TAG
                    *:*

Pathways

NCI : Noncanonical Wnt signaling pathway
NCI : Validated targets of C-MYC transcriptional repression
NCI : Wnt signaling network
Panther : Alzheimer disease-presenilin pathway
Panther : Angiogenesis
Panther : Cadherin signaling pathway
Panther : Wnt signaling pathway
Reactome : Asymmetric localization of PCP proteins
Reactome : Ca2+ pathway
Reactome : Class B/2 (Secretin family receptors)
Reactome : GPCR ligand binding
Reactome : PCP/CE pathway
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : Signaling by Wnt
Reactome : TCF dependent signaling in response to WNT
Reactome : WNT ligand biogenesis and trafficking
Reactome : WNT5A-dependent internalization of FZD2, FZD5 and ROR2
Reactome : WNT5A-dependent internalization of FZD4
Reactome : beta-catenin independent WNT signaling
Reactome : negative regulation of TCF-dependent signaling by WNT ligand antagonists
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : Epithelium TarBase
WikiPathway : Lymphocyte TarBase
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Muscle cell TarBase
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency

Protein

SMART domain : WNT1 : found in Wnt-1
UniProt : P41221
HPRD : 01293

Clone

Cloning Information : 54237
HIP Master Clone ID : 10498
Original Clone ID : FLH054237.01L

Organism


TAX_ID : 9606
Species Specific ID: 7474

Genome

Chromosome : 3
Map Location : 3p21-p14
Ensembl : ENSG00000114251

Reagents

Labome : WNT5A-antibody