DNASU Plasmid Repository • 480.965.5697 | Email

IL8 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  IL8
Gene Name:  interleukin 8
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH054107.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00001362

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 300nts         Open reading frame : 1 to 300
Reference Sequence Alignment

ATGACTTCCAAGCTGGCCGTGGCTCTCTTGGCAGCCTTCCTGATTTCTGCAGCTCTGTGT
GAAGGTGCAGTTTTGCCAAGGAGTGCTAAAGAACTTAGATGTCAGTGCATAAAGACATAC
TCCAAACCTTTCCACCCCAAATTTATCAAAGAACTGAGAGTGATTGAGAGTGGACCACAC
TGCGCCAACACAGAAATTATTGTAAAGCTTTCTGATGGAAGAGAGCTCTGTCTGGACCCC
AAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGAATTCATTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 374
Start on reference sequence 75
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : IL8
Symbol Nomenclature : IL8
SYNONYM : CXCL8; GCP-1; GCP1; LECT; LUCT; LYNAP; MDNCF; MONAP; NAF; NAP-1; NAP1
Designation : T-cell chemotactic factor|alveolar macrophage chemotactic factor I|beta endothelial cell-derived neutrophil activating peptide|beta-thromboglobulin-like protein|chemokine (C-X-C motif) ligand 8|emoctakin|granulocyte chemotactic protein 1|interleukin-8|lung giant cell carcinoma-derived chemotactic protein|lymphocyte derived neutrophil activating peptide|monocyte-derived neutrophil chemotactic factor|monocyte-derived neutrophil-activating peptide|neutrophil-activating peptide 1|small inducible cytokine subfamily B, member 8|tumor necrosis factor-induced gene 1
Full Nomenclature : interleukin 8
GENEID : 3576
GI : 60828361
GenBank Accession : AY893802
HGNC : 6025
MIM : 146930
Vega : OTTHUMG00000151316
Target GenBank: NM_000584

 

Reference Sequence Alignment

  

HsCD00001362      ATGACTTCCAAGCTGGCCGTGGCTCTCTTGGCAGCCTTCCTGATTTCTGCAGCTCTGTGT
NM_000584.3       ATGACTTCCAAGCTGGCCGTGGCTCTCTTGGCAGCCTTCCTGATTTCTGCAGCTCTGTGT
                  ************************************************************

HsCD00001362      GAAGGTGCAGTTTTGCCAAGGAGTGCTAAAGAACTTAGATGTCAGTGCATAAAGACATAC
NM_000584.3       GAAGGTGCAGTTTTGCCAAGGAGTGCTAAAGAACTTAGATGTCAGTGCATAAAGACATAC
                  ************************************************************

HsCD00001362      TCCAAACCTTTCCACCCCAAATTTATCAAAGAACTGAGAGTGATTGAGAGTGGACCACAC
NM_000584.3       TCCAAACCTTTCCACCCCAAATTTATCAAAGAACTGAGAGTGATTGAGAGTGGACCACAC
                  ************************************************************

HsCD00001362      TGCGCCAACACAGAAATTATTGTAAAGCTTTCTGATGGAAGAGAGCTCTGTCTGGACCCC
NM_000584.3       TGCGCCAACACAGAAATTATTGTAAAGCTTTCTGATGGAAGAGAGCTCTGTCTGGACCCC
                  ************************************************************

HsCD00001362      AAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGAATTCATTG
NM_000584.3       AAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGAATTCATAA
                  **********************************************************:.

Pathways

NCI : AP-1 transcription factor network
NCI : ATF-2 transcription factor network
NCI : Calcineurin-regulated NFAT-dependent transcription in lymphocytes
NCI : Glucocorticoid receptor regulatory network
NCI : IL8- and CXCR1-mediated signaling events
NCI : IL8- and CXCR2-mediated signaling events
NCI : IL8-mediated signaling events
NCI : LPA receptor mediated events
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Syndecan-2-mediated signaling events
NCI : Syndecan-3-mediated signaling events
NCI : Validated transcriptional targets of AP1 family members Fra1 and Fra2
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Interleukin signaling pathway
WikiPathway : EBV LMP1 signaling
WikiPathway : IL-3 Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : SIDS Susceptibility Pathways
WikiPathway : Senescence and Autophagy
WikiPathway : Toll-like receptor signaling pathway

Clone

Cloning Information : 54107
HIP Master Clone ID : 10368
Original Clone ID : FLH054107.01L

Organism


TAX_ID : 9606
Species Specific ID: 3576

Genome

Chromosome : 4
Map Location : 4q13-q21
Ensembl : ENSG00000169429

Reagents

Labome : IL-8-antibody