DNASU Plasmid Repository • 480.965.5697 | Email

SDC4 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SDC4
Gene Name:  syndecan 4
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH131225.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00001380

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 597nts         Open reading frame : 1 to 597
Reference Sequence Alignment

ATGGCCCCCGCCCGTCTGTTCGCGCTGCTGCTGTTCTTCGTAGGCGGAGTCGCCGAGTCG
ATCCGAGAGACTGAGGTCATCGACCCCCAGGACCTCCTAGAAGGCCGATACTTCTCCGGA
GCCCTACCAGACGATGAGGATGTAGTGGGGCCCGGGCAGGAATCTGATGACTTTGAGCTG
TCTGGCTCTGGAGATCTGGATGACTTGGAAGACTCCATGATCGGCCCTGAAGTTGTCCAT
CCCTTGGTGCCTCTAGATAACCATATCCCTGAGAGGGCAGGGTCTGGGAGCCAAGTCCCC
ACCGAACCCAAGAAACTAGAGGAGAATGAGGTTATCCCCAAGAGAATCTCACCCGTTGAA
GAGAGTGAGGATGTGTCCAACAAGGTGTCAATGTCCAGCACTGTGCAGGGCAGCAACATC
TTTGAGAGAACGGAGGTCCTGGCAGCTCTGATTGTGGGTGGCATCGTGGGCATCCTCTTT
GCCGTCTTCCTGATCCTACTGCTCATGTACCGTATGAAGAAGAAGGATGAAGGCAGCTAT
GACCTGGGCAAGAAACCCATCTACAAGAAAGCCCCCACCAATGAGTTCTACGCGTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 623
Start on reference sequence 27
Mutations:
None
Discrepancy:
c34t,L12F
                                

5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SDC4
Symbol Nomenclature : SDC4
SYNONYM : SYND4
Designation : amphiglycan|ryudocan amphiglycan|ryudocan core protein|syndecan 4 (amphiglycan, ryudocan)|syndecan proteoglycan 4|syndecan-4
Full Nomenclature : syndecan 4
GENEID : 6385
GI : 60816855
GenBank Accession : AY893362
HGNC : 10661
MIM : 600017
Vega : OTTHUMG00000033083
Target GenBank: NM_002999

 

Reference Sequence Alignment

  

HsCD00001380      ATGGCCCCCGCCCGTCTGTTCGCGCTGCTGCTGTTCTTCGTAGGCGGAGTCGCCGAGTCG
NM_002999.3       ATGGCCCCCGCCCGTCTGTTCGCGCTGCTGCTGTTCTTCGTAGGCGGAGTCGCCGAGTCG
                  ************************************************************

HsCD00001380      ATCCGAGAGACTGAGGTCATCGACCCCCAGGACCTCCTAGAAGGCCGATACTTCTCCGGA
NM_002999.3       ATCCGAGAGACTGAGGTCATCGACCCCCAGGACCTCCTAGAAGGCCGATACTTCTCCGGA
                  ************************************************************

HsCD00001380      GCCCTACCAGACGATGAGGATGTAGTGGGGCCCGGGCAGGAATCTGATGACTTTGAGCTG
NM_002999.3       GCCCTACCAGACGATGAGGATGTAGTGGGGCCCGGGCAGGAATCTGATGACTTTGAGCTG
                  ************************************************************

HsCD00001380      TCTGGCTCTGGAGATCTGGATGACTTGGAAGACTCCATGATCGGCCCTGAAGTTGTCCAT
NM_002999.3       TCTGGCTCTGGAGATCTGGATGACTTGGAAGACTCCATGATCGGCCCTGAAGTTGTCCAT
                  ************************************************************

HsCD00001380      CCCTTGGTGCCTCTAGATAACCATATCCCTGAGAGGGCAGGGTCTGGGAGCCAAGTCCCC
NM_002999.3       CCCTTGGTGCCTCTAGATAACCATATCCCTGAGAGGGCAGGGTCTGGGAGCCAAGTCCCC
                  ************************************************************

HsCD00001380      ACCGAACCCAAGAAACTAGAGGAGAATGAGGTTATCCCCAAGAGAATCTCACCCGTTGAA
NM_002999.3       ACCGAACCCAAGAAACTAGAGGAGAATGAGGTTATCCCCAAGAGAATCTCACCCGTTGAA
                  ************************************************************

HsCD00001380      GAGAGTGAGGATGTGTCCAACAAGGTGTCAATGTCCAGCACTGTGCAGGGCAGCAACATC
NM_002999.3       GAGAGTGAGGATGTGTCCAACAAGGTGTCAATGTCCAGCACTGTGCAGGGCAGCAACATC
                  ************************************************************

HsCD00001380      TTTGAGAGAACGGAGGTCCTGGCAGCTCTGATTGTGGGTGGCATCGTGGGCATCCTCTTT
NM_002999.3       TTTGAGAGAACGGAGGTCCTGGCAGCTCTGATTGTGGGTGGCATCGTGGGCATCCTCTTT
                  ************************************************************

HsCD00001380      GCCGTCTTCCTGATCCTACTGCTCATGTACCGTATGAAGAAGAAGGATGAAGGCAGCTAT
NM_002999.3       GCCGTCTTCCTGATCCTACTGCTCATGTACCGTATGAAGAAGAAGGATGAAGGCAGCTAT
                  ************************************************************

HsCD00001380      GACCTGGGCAAGAAACCCATCTACAAGAAAGCCCCCACCAATGAGTTCTACGCGTGA
NM_002999.3       GACCTGGGCAAGAAACCCATCTACAAGAAAGCCCCCACCAATGAGTTCTACGCGTGA
                  *********************************************************

Pathways

NCI : Beta3 integrin cell surface interactions
NCI : FGF signaling pathway
NCI : Proteoglycan syndecan-mediated signaling events
NCI : Syndecan-4-mediated signaling events
Reactome : A tetrasaccharide linker sequence is required for GAG synthesis
Reactome : Chondroitin sulfate/dermatan sulfate metabolism
Reactome : Disease
Reactome : Diseases associated with visual transduction
Reactome : Extracellular matrix organization
Reactome : Glycogen storage diseases
Reactome : Glycosaminoglycan metabolism
Reactome : HS-GAG biosynthesis
Reactome : HS-GAG degradation
Reactome : Heparan sulfate/heparin (HS-GAG) metabolism
Reactome : MPS I - Hurler syndrome
Reactome : MPS II - Hunter syndrome
Reactome : MPS IIIA - Sanfilippo syndrome A
Reactome : MPS IIIB - Sanfilippo syndrome B
Reactome : MPS IIIC - Sanfilippo syndrome C
Reactome : MPS IIID - Sanfilippo syndrome D
Reactome : MPS IV - Morquio syndrome A
Reactome : MPS IV - Morquio syndrome B
Reactome : MPS IX - Natowicz syndrome
Reactome : MPS VI - Maroteaux-Lamy syndrome
Reactome : MPS VII - Sly syndrome
Reactome : Metabolism
Reactome : Metabolism of carbohydrates
Reactome : Mucopolysaccharidoses
Reactome : Myoclonic epilepsy of Lafora
Reactome : Non-integrin membrane-ECM interactions
Reactome : Retinoid metabolism and transport
Reactome : Signal Transduction
Reactome : Syndecan interactions
Reactome : Visual phototransduction

Protein

SMART domain : 4.1m : putative band 4.1 homologues binding motif
UniProt : P31431
UniProt : Q6FGN3
HPRD : 08366

Clone

Cloning Information : 131225
HIP Master Clone ID : 107382
Original Clone ID : FLH131225.01X

Organism


TAX_ID : 9606
Species Specific ID: 6385

Genome

Chromosome : 20
Map Location : 20q12
Ensembl : ENSG00000124145

Reagents

Labome : SDC4-antibody