DNASU Plasmid Repository • 480.965.5697 | Email

NR0B2 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NR0B2
Gene Name:  nuclear receptor subfamily 0, group B, member 2
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH054796.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00000014

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 774nts         Open reading frame : 1 to 774
Reference Sequence Alignment

ATGAGCACCAGCCAACCAGGGGCCTGCCCATGCCAGGGAGCTGCAAGCCGCCCCGCCATT
CTCTACGCACTTCTGAGCTCCAGCCTCAAGGCTGTCCCCCGACCCCGTAGCCGCTGCCTA
TGTAGGCAGCACCGGCCCGTCCAGCTATGTGCACCTCATCGCACCTGCCGGGAGGCCTTG
GATGTTCTGGCCAAGACAGTGGCCTTCCTCAGGAACCTGCCATCCTTCTGGCAGCTGCCT
CCCCAGGACCAGCGGCGGCTGCTGCAGGGTTGCTGGGGCCCCCTCTTCCTGCTTGGGTTG
GCCCAAGATGCTGTGACCTTTGAGGTGGCTGAGGCCCCGGTGCCCAGCATACTCAAGAAG
ATTCTGCTGGAGGAGCCCAGCAGCAGTGGAGGCAGTGGCCAACTGCCAGACAGACCCCAG
CCCTCCCTGGCTGCGGTGCAGTGGCTTCAATGCTGTCTGGAGTCCTTCTGGAGCCTGGAG
CTTAGCCCCAAGGAATATGCCTGCCTGAAAGGGACCATCCTCTTCAACCCCGATGTGCCA
GGCCTCCAAGCCGCCTCCCACATTGGGCACCTGCAGCAGGAGGCTCACTGGGTGCTGTGT
GAAGTCCTGGAACCCTGGTGCCCAGCAGCCCAAGGCCGCCTGACCCGTGTCCTCCTCACG
GCCTCCACCCTCAAGTCCATTCCGACCAGCCTGCTTGGGGACCTCTTCTTTCGCCCTATC
ATTGGAGATGTTGACATCGCTGGCCTTCTTGGGGACATGCTTTTGCTCAGGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 803
Start on reference sequence 30
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NR0B2
Symbol Nomenclature : NR0B2
SYNONYM : SHP; SHP1
Designation : nuclear receptor SHP|nuclear receptor subfamily 0 group B member 2|orphan nuclear receptor SHP|small heterodimer partner
Full Nomenclature : nuclear receptor subfamily 0, group B, member 2
GENEID : 8431
GI : 60812463
GenBank Accession : AY893176
HGNC : 7961
MIM : 604630
Vega : OTTHUMG00000004231
Target GenBank: NM_021969

 

Reference Sequence Alignment

  

HsCD00000014      ATGAGCACCAGCCAACCAGGGGCCTGCCCATGCCAGGGAGCTGCAAGCCGCCCCGCCATT
NM_021969.2       ATGAGCACCAGCCAACCAGGGGCCTGCCCATGCCAGGGAGCTGCAAGCCGCCCCGCCATT
                  ************************************************************

HsCD00000014      CTCTACGCACTTCTGAGCTCCAGCCTCAAGGCTGTCCCCCGACCCCGTAGCCGCTGCCTA
NM_021969.2       CTCTACGCACTTCTGAGCTCCAGCCTCAAGGCTGTCCCCCGACCCCGTAGCCGCTGCCTA
                  ************************************************************

HsCD00000014      TGTAGGCAGCACCGGCCCGTCCAGCTATGTGCACCTCATCGCACCTGCCGGGAGGCCTTG
NM_021969.2       TGTAGGCAGCACCGGCCCGTCCAGCTATGTGCACCTCATCGCACCTGCCGGGAGGCCTTG
                  ************************************************************

HsCD00000014      GATGTTCTGGCCAAGACAGTGGCCTTCCTCAGGAACCTGCCATCCTTCTGGCAGCTGCCT
NM_021969.2       GATGTTCTGGCCAAGACAGTGGCCTTCCTCAGGAACCTGCCATCCTTCTGGCAGCTGCCT
                  ************************************************************

HsCD00000014      CCCCAGGACCAGCGGCGGCTGCTGCAGGGTTGCTGGGGCCCCCTCTTCCTGCTTGGGTTG
NM_021969.2       CCCCAGGACCAGCGGCGGCTGCTGCAGGGTTGCTGGGGCCCCCTCTTCCTGCTTGGGTTG
                  ************************************************************

HsCD00000014      GCCCAAGATGCTGTGACCTTTGAGGTGGCTGAGGCCCCGGTGCCCAGCATACTCAAGAAG
NM_021969.2       GCCCAAGATGCTGTGACCTTTGAGGTGGCTGAGGCCCCGGTGCCCAGCATACTCAAGAAG
                  ************************************************************

HsCD00000014      ATTCTGCTGGAGGAGCCCAGCAGCAGTGGAGGCAGTGGCCAACTGCCAGACAGACCCCAG
NM_021969.2       ATTCTGCTGGAGGAGCCCAGCAGCAGTGGAGGCAGTGGCCAACTGCCAGACAGACCCCAG
                  ************************************************************

HsCD00000014      CCCTCCCTGGCTGCGGTGCAGTGGCTTCAATGCTGTCTGGAGTCCTTCTGGAGCCTGGAG
NM_021969.2       CCCTCCCTGGCTGCGGTGCAGTGGCTTCAATGCTGTCTGGAGTCCTTCTGGAGCCTGGAG
                  ************************************************************

HsCD00000014      CTTAGCCCCAAGGAATATGCCTGCCTGAAAGGGACCATCCTCTTCAACCCCGATGTGCCA
NM_021969.2       CTTAGCCCCAAGGAATATGCCTGCCTGAAAGGGACCATCCTCTTCAACCCCGATGTGCCA
                  ************************************************************

HsCD00000014      GGCCTCCAAGCCGCCTCCCACATTGGGCACCTGCAGCAGGAGGCTCACTGGGTGCTGTGT
NM_021969.2       GGCCTCCAAGCCGCCTCCCACATTGGGCACCTGCAGCAGGAGGCTCACTGGGTGCTGTGT
                  ************************************************************

HsCD00000014      GAAGTCCTGGAACCCTGGTGCCCAGCAGCCCAAGGCCGCCTGACCCGTGTCCTCCTCACG
NM_021969.2       GAAGTCCTGGAACCCTGGTGCCCAGCAGCCCAAGGCCGCCTGACCCGTGTCCTCCTCACG
                  ************************************************************

HsCD00000014      GCCTCCACCCTCAAGTCCATTCCGACCAGCCTGCTTGGGGACCTCTTCTTTCGCCCTATC
NM_021969.2       GCCTCCACCCTCAAGTCCATTCCGACCAGCCTGCTTGGGGACCTCTTCTTTCGCCCTATC
                  ************************************************************

HsCD00000014      ATTGGAGATGTTGACATCGCTGGCCTTCTTGGGGACATGCTTTTGCTCAGGTAG
NM_021969.2       ATTGGAGATGTTGACATCGCTGGCCTTCTTGGGGACATGCTTTTGCTCAGGTGA
                  ****************************************************..

Pathways

NCI : Validated nuclear estrogen receptor alpha network
NCI : Validated nuclear estrogen receptor beta network
Reactome : Gene Expression
Reactome : Generic Transcription Pathway
Reactome : Nuclear Receptor transcription pathway
WikiPathway : Androgen receptor signaling pathway

Protein

SMART domain : HOLI : Ligand binding domain of hormone receptors
UniProt : Q15466
UniProt : F1D8P5
HPRD : 05219

Clone

Cloning Information : 54796
HIP Master Clone ID : 13074
Original Clone ID : FLH054796.01X

Organism


TAX_ID : 9606
Species Specific ID: 8431

Genome

Chromosome : 1
Map Location : 1p36.1
Ensembl : ENSG00000131910

Reagents

Labome : NR0B2-antibody