DNASU Plasmid Repository • 480.965.5697 | Email

ARHA (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RHOA
Gene Name:  ras homolog family member A
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH054395.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00001429

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 582nts         Open reading frame : 1 to 582
Reference Sequence Alignment

ATGGCTGCCATCCGGAAGAAACTGGTGATTGTTGGTGATGGAGCCTGTGGAAAGACATGC
TTGCTCATAGTCTTCAGCAAGGACCAGTTCCCAGAGGTGTATGTGCCCACAGTGTTTGAG
AACTATGTGGCAGATATCGAGGTGGATGGAAAGCAGGTAGAGTTGGCTTTGTGGGACACA
GCTGGGCAGGAAGATTATGATCGCCTGAGGCCCCTCTCCTACCCAGATACCGATGTTATA
CTGATGTGTTTTTCCATCGACAGCCCTGATAGTTTAGAAAACATCCCAGAAAAGTGGACC
CCAGAAGTCAAGCATTTCTGTCCCAACGTGCCCATCATCCTGGTTGGGAATAAGAAGGAT
CTTCGGAATGATGAGCACACAAGGCGGGAGCTAGCCAAGATGAAGCAGGAGCCGGTGAAA
CCTGAAGAAGGCAGAGATATGGCAAACAGGATTGGCGCTTTTGGGTACATGGAGTGTTCA
GCAAAGACCAAAGATGGAGTGAGAGAGGTTTTTGAAATGGCTACGAGAGCTGCTCTGCAA
GCTAGACGTGGGAAGAAAAAATCTGGTTGCCTTGTCTTGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 733
Start on reference sequence 152
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RHOA
Symbol Nomenclature : RHOA
SYNONYM : ARH12; ARHA; RHO12; RHOH12
Designation : Aplysia ras-related homolog 12|h12|oncogene RHO H12|ras homolog gene family, member A|rho cDNA clone 12|small GTP binding protein RhoA|transforming protein RhoA
Full Nomenclature : ras homolog family member A
GENEID : 387
GI : 60828919
GenBank Accession : AY893821
HGNC : 667
MIM : 165390
Vega : OTTHUMG00000156838
Target GenBank: NM_001664

 

Reference Sequence Alignment

  

HsCD00001429        ATGGCTGCCATCCGGAAGAAACTGGTGATTGTTGGTGATGGAGCCTGTGGAAAGACATGC
NM_001664.2         ATGGCTGCCATCCGGAAGAAACTGGTGATTGTTGGTGATGGAGCCTGTGGAAAGACATGC
NM_001042678.1      ATGGCTGCAATCCGAAAGAAGCTGGTGATCGTTGGGGATGGTGCCTGTGGGAAGACCTGC
NM_001042679.1      ATGGCTGCAATCCGAAAGAAGCTGGTGATCGTTGGGGATGGTGCCTGTGGGAAGACCTGC
NM_175744.4         ATGGCTGCAATCCGAAAGAAGCTGGTGATCGTTGGGGATGGTGCCTGTGGGAAGACCTGC
                    ********.*****.*****.******** ***** *****:********.*****.***

HsCD00001429        TTGCTCATAGTCTTCAGCAAGGACCAGTTCCCAGAGGTGTATGTGCCCACAGTGTTTGAG
NM_001664.2         TTGCTCATAGTCTTCAGCAAGGACCAGTTCCCAGAGGTGTATGTGCCCACAGTGTTTGAG
NM_001042678.1      CTCCTCATCGTCTTCAGCAAGGATCAGTTTCCGGAGGTCTACGTCCCTACTGTCTTTGAG
NM_001042679.1      CTCCTCATCGTCTTCAGCAAGGATCAGTTTCCGGAGGTCTACGTCCCTACTGTCTTTGAG
NM_175744.4         CTCCTCATCGTCTTCAGCAAGGATCAGTTTCCGGAGGTCTACGTCCCTACTGTCTTTGAG
                     * *****.************** ***** **.***** ** ** ** **:** ******

HsCD00001429        AACTATGTGGCAGATATCGAGGTGGATGGAAAGCAGGTAGAGTTGGCTTTGTGGGACACA
NM_001664.2         AACTATGTGGCAGATATCGAGGTGGATGGAAAGCAGGTAGAGTTGGCTTTGTGGGACACA
NM_001042678.1      AACTATATTGCGGACATTGAGGTGGACGGCAAGCAGGTGGAGCTGGCTCTGTGGGACACA
NM_001042679.1      AACTATATTGCGGACATTGAGGTGGACGGCAAGCAGGTGGAGCTGGCTCTGTGGGACACA
NM_175744.4         AACTATATTGCGGACATTGAGGTGGACGGCAAGCAGGTGGAGCTGGCTCTGTGGGACACA
                    ******.* **.** ** ******** **.********.*** ***** ***********

HsCD00001429        GCTGGGCAGGAAGATTATGATCGCCTGAGGCCCCTCTCCTACCCAGATACCGATGTTATA
NM_001664.2         GCTGGGCAGGAAGATTATGATCGCCTGAGGCCCCTCTCCTACCCAGATACCGATGTTATA
NM_001042678.1      GCAGGGCAGGAAGACTATGATCGACTGCGGCCTCTCTCCTACCCGGACACTGATGTCATC
NM_001042679.1      GCAGGGCAGGAAGACTATGATCGACTGCGGCCTCTCTCCTACCCGGACACTGATGTCATC
NM_175744.4         GCAGGGCAGGAAGACTATGATCGACTGCGGCCTCTCTCCTACCCGGACACTGATGTCATC
                    **:*********** ********.***.**** ***********.** ** ***** **.

HsCD00001429        CTGATGTGTTTTTCCATCGACAGCCCTGATAGTTTAGAAAACATCCCAGAAAAGTGGACC
NM_001664.2         CTGATGTGTTTTTCCATCGACAGCCCTGATAGTTTAGAAAACATCCCAGAAAAGTGGACC
NM_001042678.1      CTCATGTGCTTCTCCATCGACAGCCCTGACAGCCTGGAAAACATTCCTGAGAAGTGGACC
NM_001042679.1      CTCATGTGCTTCTCCATCGACAGCCCTGACAGCCTGGAAAACATTCCTGAGAAGTGGACC
NM_175744.4         CTCATGTGCTTCTCCATCGACAGCCCTGACAGCCTGGAAAACATTCCTGAGAAGTGGACC
                    ** ***** ** ***************** **  *.******** **:**.*********

HsCD00001429        CCAGAAGTCAAGCATTTCTGTCCCAACGTGCCCATCATCCTGGTTGGGAATAAGAAGGAT
NM_001664.2         CCAGAAGTCAAGCATTTCTGTCCCAACGTGCCCATCATCCTGGTTGGGAATAAGAAGGAT
NM_001042678.1      CCAGAGGTGAAGCACTTCTGCCCCAACGTGCCCATCATCCTGGTGGGGAATAAGAAGGAC
NM_001042679.1      CCAGAGGTGAAGCACTTCTGCCCCAACGTGCCCATCATCCTGGTGGGGAATAAGAAGGAC
NM_175744.4         CCAGAGGTGAAGCACTTCTGCCCCAACGTGCCCATCATCCTGGTGGGGAATAAGAAGGAC
                    *****.** ***** ***** *********************** ************** 

HsCD00001429        CTTCGGAATGATGAGCACACAAGGCGGGAGCTAGCCAAGATGAAGCAGGAGCCGGTGAAA
NM_001664.2         CTTCGGAATGATGAGCACACAAGGCGGGAGCTAGCCAAGATGAAGCAGGAGCCGGTGAAA
NM_001042678.1      CTGAGGCAAGACGAGCACACCAGGAGAGAGCTGGCCAAGATGAAGCAGGAGCCCGTTCGG
NM_001042679.1      CTGAGGCAAGACGAGCACACCAGGAGAGAGCTGGCCAAGATGAAGCAGGAGCCCGTTCGG
NM_175744.4         CTGAGGCAAGACGAGCACACCAGGAGAGAGCTGGCCAAGATGAAGCAGGAGCCCGTTCGG
                    ** .**.*:** ********.***.*.*****.******************** ** ...

HsCD00001429        CCTGAAGAAGGCAGAGATATGGCAAACAGGATTGGCGCTTTTGGGTACATGGAGTGTTCA
NM_001664.2         CCTGAAGAAGGCAGAGATATGGCAAACAGGATTGGCGCTTTTGGGTACATGGAGTGTTCA
NM_001042678.1      TCTGAGGAAGGCCGGGACATGGCGAACCGGATCAGTGCCTTTGGCTACCTTGAGTGCTCA
NM_001042679.1      TCTGAGGAAGGCCGGGACATGGCGAACCGGATCAGTGCCTTTGGCTACCTTGAGTGCTCA
NM_175744.4         TCTGAGGAAGGCCGGGACATGGCGAACCGGATCAGTGCCTTTGGCTACCTTGAGTGCTCA
                     ****.******.*.** *****.***.**** .* ** ***** ***.* ***** ***

HsCD00001429        GCAAAGACCAAAGATGGAGTGAGAGAGGTTTTTGAAATGGCTACGAGAGCTGCTCTGCAA
NM_001664.2         GCAAAGACCAAAGATGGAGTGAGAGAGGTTTTTGAAATGGCTACGAGAGCTGCTCTGCAA
NM_001042678.1      GCCAAGACCAAGGAGGGAGTGCGGGAGGTGTTTGAGATGGCCACTCGGGCTGGCCTCCAG
NM_001042679.1      GCCAAGACCAAGGAGGGAGTGCGGGAGGTGTTTGAGATGGCCACTCGGGCTGGCCTCCAG
NM_175744.4         GCCAAGACCAAGGAGGGAGTGCGGGAGGTGTTTGAGATGGCCACTCGGGCTGGCCTCCAG
                    **.********.** ******.*.***** *****.***** ** .*.****  ** **.

HsCD00001429        GCTAGACGTGGGAAGAAAAAATCTGGTTGCCTTGTCTTGTTG
NM_001664.2         GCTAGACGTGGGAAGAAAAAATCTGGGTGCCTTGTCTTGTGA
NM_001042678.1      GTCCGCAAGAACAAGCGTCGGAGGGGCTGTCCCATTCTCTGA
NM_001042679.1      GTCCGCAAGAACAAGCGTCGGAGGGGCTGTCCCATTCTCTGA
NM_175744.4         GTCCGCAAGAACAAGCGTCGGAGGGGCTGTCCCATTCTCTGA
                    *  .*... .. ***..:...:  ** ** *  .*  * * .

Pathways

NCI : Arf6 downstream pathway
NCI : Aurora B signaling
NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : E-cadherin signaling in keratinocytes
NCI : E-cadherin signaling in the nascent adherens junction
NCI : EPHA forward signaling
NCI : EPHA2 forward signaling
NCI : Endogenous TLR signaling
NCI : Endothelins
NCI : IL2-mediated signaling events
NCI : Integrins in angiogenesis
NCI : LPA receptor mediated events
NCI : Lissencephaly gene (LIS1) in neuronal migration and development
NCI : N-cadherin signaling events
NCI : Netrin-mediated signaling events
NCI : Neurotrophic factor-mediated Trk receptor signaling
NCI : Noncanonical Wnt signaling pathway
NCI : Osteopontin-mediated events
NCI : PAR1-mediated thrombin signaling events
NCI : PAR4-mediated thrombin signaling events
NCI : PDGFR-beta signaling pathway
NCI : PLK1 signaling events
NCI : Plasma membrane estrogen receptor signaling
NCI : Regulation of RhoA activity
NCI : RhoA signaling pathway
NCI : S1P1 pathway
NCI : S1P2 pathway
NCI : S1P3 pathway
NCI : S1P4 pathway
NCI : S1P5 pathway
NCI : SHP2 signaling
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by PRL
NCI : Signaling events mediated by PTP1B
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling events mediated by focal adhesion kinase
NCI : Signaling events regulated by Ret tyrosine kinase
NCI : Stabilization and expansion of the E-cadherin adherens junction
NCI : Syndecan-2-mediated signaling events
NCI : Syndecan-4-mediated signaling events
NCI : TGF-beta receptor signaling
NCI : Thromboxane A2 receptor signaling
NCI : a4b7 Integrin signaling
NCI : amb2 Integrin signaling
NCI : mTOR signaling pathway
NCI : p75(NTR)-mediated signaling
Panther : Angiogenesis
Panther : Axon guidance mediated by semaphorins
Panther : Heterotrimeric G-protein signaling pathway-Gq alpha and Go alpha mediated pathway
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Integrin signalling pathway
Panther : Ras Pathway
Reactome : Axon guidance
Reactome : Axonal growth inhibition (RHOA activation)
Reactome : Axonal growth stimulation
Reactome : Developmental Biology
Reactome : Disease
Reactome : G alpha (12/13) signalling events
Reactome : G beta:gamma signalling through PI3Kgamma
Reactome : G-protein beta:gamma signalling
Reactome : GPCR downstream signaling
Reactome : GPVI-mediated activation cascade
Reactome : Hemostasis
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : PCP/CE pathway
Reactome : PI3K/AKT activation
Reactome : Platelet activation, signaling and aggregation
Reactome : Rho GTPase cycle
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : Sema4D in semaphorin signaling
Reactome : Sema4D induced cell migration and growth-cone collapse
Reactome : Sema4D mediated inhibition of cell attachment and migration
Reactome : Semaphorin interactions
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : Signaling by Rho GTPases
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : Signaling by Wnt
Reactome : Signalling by NGF
Reactome : TGF-beta receptor signaling in EMT (epithelial to mesenchymal transition)
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer
Reactome : beta-catenin independent WNT signaling
Reactome : p75 NTR receptor-mediated signalling
Reactome : p75NTR regulates axonogenesis
WikiPathway : Alpha 6 Beta 4 signaling pathway
WikiPathway : Androgen receptor signaling pathway
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : Focal Adhesion
WikiPathway : G Protein Signaling Pathways
WikiPathway : G13 Signaling Pathway
WikiPathway : Leptin signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Physiological and Pathological Hypertrophy of the Heart
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Serotonin HTR1 Group and FOS Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency

Clone

Cloning Information : 54395
HIP Master Clone ID : 10656
Original Clone ID : FLH054395.01L

Organism


TAX_ID : 9606
Species Specific ID: 387

Genome

Chromosome : 3
Map Location : 3p21.3
Ensembl : ENSG00000067560

Reagents

Labome : RhoA-antibody