DNASU Plasmid Repository • 480.965.2857 | Email

PTEN (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PTEN
Gene Name:  phosphatase and tensin homolog
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH130080.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00001438

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1212nts         Open reading frame : 1 to 1212
Reference Sequence Alignment

ATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACAAAAGGAGATATCAAGAGGATGGA
TTCGACTTAGACTTGACCTATATTTATCCAAACATTATTGCTATGGGATTTCCTGCAGAA
AGACTTGAAGGCGTATACAGGAACAATATTGATGATGTAGTAAGGTTTTTGGATTCAAAG
CATAAAAACCATTACAAGATATACAATCTTTGTGCTGAAAGACATTATGACACCGCCAAA
TTTAATTGCAGAGTTGCACAATATCCTTTTGAAGACCATAACCCACCACAGCTAGAACTT
ATCAAACCCTTTTGTGAAGATCTTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCA
GCAATTCACTGTAAAGCTGGAAAGGGACGAACTGGTGTAATGATATGTGCATATTTATTA
CATCGGGGCAAATTTTTAAAGGCACAAGAGGCCCTAGATTTCTATGGGGAAGTAAGGACC
AGAGACAAAAAGGGAGTAACTATTCCCAGTCAGAGGCGCTATGTGTATTATTATAGCTAC
CTGTTAAAGAATCATCTGGATTATAGACCAGTGGCACTGTTGTTTCACAAGATGATGTTT
GAAACTATTCCAATGTTCAGTGGCGGAACTTGCAATCCTCAGTTTGTGGTCTGCCAGCTA
AAGGTGAAGATATATTCCTCCAATTCAGGACCCACACGACGGGAAGACAAGTTCATGTAC
TTTGAGTTCCCTCAGCCGTTACCTGTGTGTGGTGATATCAAAGTAGAGTTCTTCCACAAA
CAGAACAAGATGCTAAAAAAGGACAAAATGTTTCACTTTTGGGTAAATACATTCTTCATA
CCAGGACCAGAGGAAACCTCAGAAAAAGTAGAAAATGGAAGTCTATGTGATCAAGAAATC
GATAGCATTTGCAGTATAGAGCGTGCAGATAATTACAAGGAATATCTAGTACTTACTTTA
ACAAAAAATGATCTTGACAAAGCAAATAAAGACAAAGCCAACCGATACTTTTCTCCAAAT
TTTAAGGTGAAGCTGTACTTCACAAAAACAGTAGAGGAGCCGTCAAATCCAGAGGCTAGC
AGTTCAACTTCTGTAACACCAGATGTTAGTGACAATGAACCTGATCATTATAGATATTCT
GACACCACTGACTCTGATCCAGAGAATGAACCTTTTGATGAAGATCAGCATACACAAATT
ACAAAAGTCTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2246
Start on reference sequence 1035
Mutations:
None
Discrepancy:
g934t,D312Y
                                

5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PTEN
Symbol Nomenclature : PTEN
SYNONYM : 10q23del; BZS; CWS1; DEC; GLM2; MHAM; MMAC1; PTEN1; TEP1
Designation : MMAC1 phosphatase and tensin homolog deleted on chromosome 10|mutated in multiple advanced cancers 1|phosphatase and tensin-like protein|phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase PTEN|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase PTEN
Full Nomenclature : phosphatase and tensin homolog
GENEID : 5728
GI : 60817197
GenBank Accession : AY893376
HGNC : 9588
MIM : 601728
Target GenBank: NM_000314

 

Reference Sequence Alignment

  

HsCD00001438      ATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACAAAAGGAGATATCAAGAGGATGGA
NM_000314.4       ATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACAAAAGGAGATATCAAGAGGATGGA
                  ************************************************************

HsCD00001438      TTCGACTTAGACTTGACCTATATTTATCCAAACATTATTGCTATGGGATTTCCTGCAGAA
NM_000314.4       TTCGACTTAGACTTGACCTATATTTATCCAAACATTATTGCTATGGGATTTCCTGCAGAA
                  ************************************************************

HsCD00001438      AGACTTGAAGGCGTATACAGGAACAATATTGATGATGTAGTAAGGTTTTTGGATTCAAAG
NM_000314.4       AGACTTGAAGGCGTATACAGGAACAATATTGATGATGTAGTAAGGTTTTTGGATTCAAAG
                  ************************************************************

HsCD00001438      CATAAAAACCATTACAAGATATACAATCTTTGTGCTGAAAGACATTATGACACCGCCAAA
NM_000314.4       CATAAAAACCATTACAAGATATACAATCTTTGTGCTGAAAGACATTATGACACCGCCAAA
                  ************************************************************

HsCD00001438      TTTAATTGCAGAGTTGCACAATATCCTTTTGAAGACCATAACCCACCACAGCTAGAACTT
NM_000314.4       TTTAATTGCAGAGTTGCACAATATCCTTTTGAAGACCATAACCCACCACAGCTAGAACTT
                  ************************************************************

HsCD00001438      ATCAAACCCTTTTGTGAAGATCTTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCA
NM_000314.4       ATCAAACCCTTTTGTGAAGATCTTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCA
                  ************************************************************

HsCD00001438      GCAATTCACTGTAAAGCTGGAAAGGGACGAACTGGTGTAATGATATGTGCATATTTATTA
NM_000314.4       GCAATTCACTGTAAAGCTGGAAAGGGACGAACTGGTGTAATGATATGTGCATATTTATTA
                  ************************************************************

HsCD00001438      CATCGGGGCAAATTTTTAAAGGCACAAGAGGCCCTAGATTTCTATGGGGAAGTAAGGACC
NM_000314.4       CATCGGGGCAAATTTTTAAAGGCACAAGAGGCCCTAGATTTCTATGGGGAAGTAAGGACC
                  ************************************************************

HsCD00001438      AGAGACAAAAAGGGAGTAACTATTCCCAGTCAGAGGCGCTATGTGTATTATTATAGCTAC
NM_000314.4       AGAGACAAAAAGGGAGTAACTATTCCCAGTCAGAGGCGCTATGTGTATTATTATAGCTAC
                  ************************************************************

HsCD00001438      CTGTTAAAGAATCATCTGGATTATAGACCAGTGGCACTGTTGTTTCACAAGATGATGTTT
NM_000314.4       CTGTTAAAGAATCATCTGGATTATAGACCAGTGGCACTGTTGTTTCACAAGATGATGTTT
                  ************************************************************

HsCD00001438      GAAACTATTCCAATGTTCAGTGGCGGAACTTGCAATCCTCAGTTTGTGGTCTGCCAGCTA
NM_000314.4       GAAACTATTCCAATGTTCAGTGGCGGAACTTGCAATCCTCAGTTTGTGGTCTGCCAGCTA
                  ************************************************************

HsCD00001438      AAGGTGAAGATATATTCCTCCAATTCAGGACCCACACGACGGGAAGACAAGTTCATGTAC
NM_000314.4       AAGGTGAAGATATATTCCTCCAATTCAGGACCCACACGACGGGAAGACAAGTTCATGTAC
                  ************************************************************

HsCD00001438      TTTGAGTTCCCTCAGCCGTTACCTGTGTGTGGTGATATCAAAGTAGAGTTCTTCCACAAA
NM_000314.4       TTTGAGTTCCCTCAGCCGTTACCTGTGTGTGGTGATATCAAAGTAGAGTTCTTCCACAAA
                  ************************************************************

HsCD00001438      CAGAACAAGATGCTAAAAAAGGACAAAATGTTTCACTTTTGGGTAAATACATTCTTCATA
NM_000314.4       CAGAACAAGATGCTAAAAAAGGACAAAATGTTTCACTTTTGGGTAAATACATTCTTCATA
                  ************************************************************

HsCD00001438      CCAGGACCAGAGGAAACCTCAGAAAAAGTAGAAAATGGAAGTCTATGTGATCAAGAAATC
NM_000314.4       CCAGGACCAGAGGAAACCTCAGAAAAAGTAGAAAATGGAAGTCTATGTGATCAAGAAATC
                  ************************************************************

HsCD00001438      GATAGCATTTGCAGTATAGAGCGTGCAGATAATTACAAGGAATATCTAGTACTTACTTTA
NM_000314.4       GATAGCATTTGCAGTATAGAGCGTGCAGATAATGACAAGGAATATCTAGTACTTACTTTA
                  ********************************* **************************

HsCD00001438      ACAAAAAATGATCTTGACAAAGCAAATAAAGACAAAGCCAACCGATACTTTTCTCCAAAT
NM_000314.4       ACAAAAAATGATCTTGACAAAGCAAATAAAGACAAAGCCAACCGATACTTTTCTCCAAAT
                  ************************************************************

HsCD00001438      TTTAAGGTGAAGCTGTACTTCACAAAAACAGTAGAGGAGCCGTCAAATCCAGAGGCTAGC
NM_000314.4       TTTAAGGTGAAGCTGTACTTCACAAAAACAGTAGAGGAGCCGTCAAATCCAGAGGCTAGC
                  ************************************************************

HsCD00001438      AGTTCAACTTCTGTAACACCAGATGTTAGTGACAATGAACCTGATCATTATAGATATTCT
NM_000314.4       AGTTCAACTTCTGTAACACCAGATGTTAGTGACAATGAACCTGATCATTATAGATATTCT
                  ************************************************************

HsCD00001438      GACACCACTGACTCTGATCCAGAGAATGAACCTTTTGATGAAGATCAGCATACACAAATT
NM_000314.4       GACACCACTGACTCTGATCCAGAGAATGAACCTTTTGATGAAGATCAGCATACACAAATT
                  ************************************************************

HsCD00001438      ACAAAAGTCTGA
NM_000314.4       ACAAAAGTCTGA
                  ************

Pathways

NCI : AP-1 transcription factor network
NCI : BCR signaling pathway
NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : Direct p53 effectors
NCI : PDGFR-beta signaling pathway
NCI : RhoA signaling pathway
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : TCR signaling in naïve CD4+ T cells
Panther : Hypoxia response via HIF activation
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : PI3 kinase pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : Adaptive Immune System
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream TCR signaling
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Inositol phosphate metabolism
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Negative regulation of the PI3K/AKT network
Reactome : PI Metabolism
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Phospholipid metabolism
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : Synthesis of IP3 and IP4 in the cytosol
Reactome : Synthesis of PIPs at the plasma membrane
Reactome : TCR signaling
WikiPathway : Androgen receptor signaling pathway
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Focal Adhesion
WikiPathway : Insulin Signaling
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : Senescence and Autophagy
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor

Clone

Cloning Information : 130080
HIP Master Clone ID : 106229
Original Clone ID : FLH130080.01X

Organism


TAX_ID : 9606
Species Specific ID: 5728

Genome

Chromosome : 10
Map Location : 10q23.3

Reagents

Labome : PTEN-antibody