DNASU Plasmid Repository • 480.965.5697 | Email

CDK6 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CDK6
Gene Name:  cyclin-dependent kinase 6
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH054525.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00001454

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 981nts         Open reading frame : 1 to 981
Reference Sequence Alignment

ATGGAGAAGGACGGCCTGTGCCGCGCTGACCAGCAGTACGAATGCGTGGCGGAGATCGGG
GAGGGCGCCTATGGGAAGGTGTTCAAGGCCCGCGACTTGAAGAACGGAGGCCGTTTCGTG
GCGTTGAAGCGCGTGCGGGTGCAGACCGGCGAGGAGGGCATGCCGCTCTCCACCATCCGC
GAGGTGGCGGTGCTGAGGCACCTGGAGACCTTCGAGCACCCCAACGTGGTCAGGTTGTTT
GATGTGTGCACAGTGTCACGAACAGACAGAGAAACCAAACTAACTTTAGTGTTTGAACAT
GTCGATCAAGACTTGACCACTTACTTGGATAAAGTTCCAGAGCCTGGAGTGCCCACTGAA
ACCATAAAGGATATGATGTTTCAGCTTCTCCGAGGTCTGGACTTTCTTCATTCACACCGA
GTAGTGCATCGCGATCTAAAACCACAGAACATTCTGGTGACCAGCAGCGGACAAATAAAA
CTCGCTGACTTCGGCCTTGCCCGCATCTATAGTTTCCAGATGGCTCTAACCTCAGTGGTC
GTCACGCTGTGGTACAGAGCACCCGAAGTCTTGCTCCAGTCCAGCTACGCCACCCCCGTG
GATCTCTGGAGTGTTGGCTGCATATTTGCAGAAATGTTTCGTAGAAAGCCTCTTTTTCGT
GGAAGTTCAGATGTTGATCAACTAGGAAAAATCTTGGACGTGATTGGACTCCCAGGAGAA
GAAGACTGGCCTAGAGATGTTGCCCTTCCCAGGCAGGCTTTTCATTCAAAATCTGCCCAA
CCAATTGAGAAGTTTGTAACAGATATCGATGAACTAGGCAAAGACCTACTTCTGAAGTGT
TTGACATTTAACCCAGCCAAAAGAATATCTGCCTACAGTGCCCTGTCTCACCCATACTTC
CAGGACCTGGAAAGGTGCAAAGAAAACCTGGATTCCCACCTGCCGCCCAGCCAGAACACC
TCGGAGCTGAATACAGCCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1098
Start on reference sequence 118
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CDK6
Symbol Nomenclature : CDK6
SYNONYM : PLSTIRE
Designation : cell division protein kinase 6|serine/threonine-protein kinase PLSTIRE
Full Nomenclature : cyclin-dependent kinase 6
GENEID : 1021
GI : 60829150
GenBank Accession : AY893830
HGNC : 1777
MIM : 603368
Vega : OTTHUMG00000131697
Target GenBank: NM_001259

 

Reference Sequence Alignment

  

HsCD00001454        ATGGAGAAGGACGGCCTGTGCCGCGCTGACCAGCAGTACGAATGCGTGGCGGAGATCGGG
NM_001259.6         ATGGAGAAGGACGGCCTGTGCCGCGCTGACCAGCAGTACGAATGCGTGGCGGAGATCGGG
NM_001145306.1      ATGGAGAAGGACGGCCTGTGCCGCGCTGACCAGCAGTACGAATGCGTGGCGGAGATCGGG
                    ************************************************************

HsCD00001454        GAGGGCGCCTATGGGAAGGTGTTCAAGGCCCGCGACTTGAAGAACGGAGGCCGTTTCGTG
NM_001259.6         GAGGGCGCCTATGGGAAGGTGTTCAAGGCCCGCGACTTGAAGAACGGAGGCCGTTTCGTG
NM_001145306.1      GAGGGCGCCTATGGGAAGGTGTTCAAGGCCCGCGACTTGAAGAACGGAGGCCGTTTCGTG
                    ************************************************************

HsCD00001454        GCGTTGAAGCGCGTGCGGGTGCAGACCGGCGAGGAGGGCATGCCGCTCTCCACCATCCGC
NM_001259.6         GCGTTGAAGCGCGTGCGGGTGCAGACCGGCGAGGAGGGCATGCCGCTCTCCACCATCCGC
NM_001145306.1      GCGTTGAAGCGCGTGCGGGTGCAGACCGGCGAGGAGGGCATGCCGCTCTCCACCATCCGC
                    ************************************************************

HsCD00001454        GAGGTGGCGGTGCTGAGGCACCTGGAGACCTTCGAGCACCCCAACGTGGTCAGGTTGTTT
NM_001259.6         GAGGTGGCGGTGCTGAGGCACCTGGAGACCTTCGAGCACCCCAACGTGGTCAGGTTGTTT
NM_001145306.1      GAGGTGGCGGTGCTGAGGCACCTGGAGACCTTCGAGCACCCCAACGTGGTCAGGTTGTTT
                    ************************************************************

HsCD00001454        GATGTGTGCACAGTGTCACGAACAGACAGAGAAACCAAACTAACTTTAGTGTTTGAACAT
NM_001259.6         GATGTGTGCACAGTGTCACGAACAGACAGAGAAACCAAACTAACTTTAGTGTTTGAACAT
NM_001145306.1      GATGTGTGCACAGTGTCACGAACAGACAGAGAAACCAAACTAACTTTAGTGTTTGAACAT
                    ************************************************************

HsCD00001454        GTCGATCAAGACTTGACCACTTACTTGGATAAAGTTCCAGAGCCTGGAGTGCCCACTGAA
NM_001259.6         GTCGATCAAGACTTGACCACTTACTTGGATAAAGTTCCAGAGCCTGGAGTGCCCACTGAA
NM_001145306.1      GTCGATCAAGACTTGACCACTTACTTGGATAAAGTTCCAGAGCCTGGAGTGCCCACTGAA
                    ************************************************************

HsCD00001454        ACCATAAAGGATATGATGTTTCAGCTTCTCCGAGGTCTGGACTTTCTTCATTCACACCGA
NM_001259.6         ACCATAAAGGATATGATGTTTCAGCTTCTCCGAGGTCTGGACTTTCTTCATTCACACCGA
NM_001145306.1      ACCATAAAGGATATGATGTTTCAGCTTCTCCGAGGTCTGGACTTTCTTCATTCACACCGA
                    ************************************************************

HsCD00001454        GTAGTGCATCGCGATCTAAAACCACAGAACATTCTGGTGACCAGCAGCGGACAAATAAAA
NM_001259.6         GTAGTGCATCGCGATCTAAAACCACAGAACATTCTGGTGACCAGCAGCGGACAAATAAAA
NM_001145306.1      GTAGTGCATCGCGATCTAAAACCACAGAACATTCTGGTGACCAGCAGCGGACAAATAAAA
                    ************************************************************

HsCD00001454        CTCGCTGACTTCGGCCTTGCCCGCATCTATAGTTTCCAGATGGCTCTAACCTCAGTGGTC
NM_001259.6         CTCGCTGACTTCGGCCTTGCCCGCATCTATAGTTTCCAGATGGCTCTAACCTCAGTGGTC
NM_001145306.1      CTCGCTGACTTCGGCCTTGCCCGCATCTATAGTTTCCAGATGGCTCTAACCTCAGTGGTC
                    ************************************************************

HsCD00001454        GTCACGCTGTGGTACAGAGCACCCGAAGTCTTGCTCCAGTCCAGCTACGCCACCCCCGTG
NM_001259.6         GTCACGCTGTGGTACAGAGCACCCGAAGTCTTGCTCCAGTCCAGCTACGCCACCCCCGTG
NM_001145306.1      GTCACGCTGTGGTACAGAGCACCCGAAGTCTTGCTCCAGTCCAGCTACGCCACCCCCGTG
                    ************************************************************

HsCD00001454        GATCTCTGGAGTGTTGGCTGCATATTTGCAGAAATGTTTCGTAGAAAGCCTCTTTTTCGT
NM_001259.6         GATCTCTGGAGTGTTGGCTGCATATTTGCAGAAATGTTTCGTAGAAAGCCTCTTTTTCGT
NM_001145306.1      GATCTCTGGAGTGTTGGCTGCATATTTGCAGAAATGTTTCGTAGAAAGCCTCTTTTTCGT
                    ************************************************************

HsCD00001454        GGAAGTTCAGATGTTGATCAACTAGGAAAAATCTTGGACGTGATTGGACTCCCAGGAGAA
NM_001259.6         GGAAGTTCAGATGTTGATCAACTAGGAAAAATCTTGGACGTGATTGGACTCCCAGGAGAA
NM_001145306.1      GGAAGTTCAGATGTTGATCAACTAGGAAAAATCTTGGACGTGATTGGACTCCCAGGAGAA
                    ************************************************************

HsCD00001454        GAAGACTGGCCTAGAGATGTTGCCCTTCCCAGGCAGGCTTTTCATTCAAAATCTGCCCAA
NM_001259.6         GAAGACTGGCCTAGAGATGTTGCCCTTCCCAGGCAGGCTTTTCATTCAAAATCTGCCCAA
NM_001145306.1      GAAGACTGGCCTAGAGATGTTGCCCTTCCCAGGCAGGCTTTTCATTCAAAATCTGCCCAA
                    ************************************************************

HsCD00001454        CCAATTGAGAAGTTTGTAACAGATATCGATGAACTAGGCAAAGACCTACTTCTGAAGTGT
NM_001259.6         CCAATTGAGAAGTTTGTAACAGATATCGATGAACTAGGCAAAGACCTACTTCTGAAGTGT
NM_001145306.1      CCAATTGAGAAGTTTGTAACAGATATCGATGAACTAGGCAAAGACCTACTTCTGAAGTGT
                    ************************************************************

HsCD00001454        TTGACATTTAACCCAGCCAAAAGAATATCTGCCTACAGTGCCCTGTCTCACCCATACTTC
NM_001259.6         TTGACATTTAACCCAGCCAAAAGAATATCTGCCTACAGTGCCCTGTCTCACCCATACTTC
NM_001145306.1      TTGACATTTAACCCAGCCAAAAGAATATCTGCCTACAGTGCCCTGTCTCACCCATACTTC
                    ************************************************************

HsCD00001454        CAGGACCTGGAAAGGTGCAAAGAAAACCTGGATTCCCACCTGCCGCCCAGCCAGAACACC
NM_001259.6         CAGGACCTGGAAAGGTGCAAAGAAAACCTGGATTCCCACCTGCCGCCCAGCCAGAACACC
NM_001145306.1      CAGGACCTGGAAAGGTGCAAAGAAAACCTGGATTCCCACCTGCCGCCCAGCCAGAACACC
                    ************************************************************

HsCD00001454        TCGGAGCTGAATACAGCCTTG
NM_001259.6         TCGGAGCTGAATACAGCCTGA
NM_001145306.1      TCGGAGCTGAATACAGCCTGA
                    ******************* .

Pathways

NCI : C-MYB transcription factor network
NCI : Coregulation of Androgen receptor activity
NCI : IL2 signaling events mediated by STAT5
NCI : Regulation of retinoblastoma protein
NCI : p73 transcription factor network
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Cyclin D associated events in G1
Reactome : G1 Phase
Reactome : Mitotic G1-G1/S phases
Reactome : Oncogene Induced Senescence
Reactome : Oxidative Stress Induced Senescence
Reactome : Senescence-Associated Secretory Phenotype (SASP)
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : Epithelium TarBase
WikiPathway : G1 to S cell cycle control
WikiPathway : Leukocyte TarBase
WikiPathway : Lymphocyte TarBase
WikiPathway : Muscle cell TarBase
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : miRNAs involved in DDR

Clone

Cloning Information : 54525
HIP Master Clone ID : 10786
Original Clone ID : FLH054525.01L

Organism


TAX_ID : 9606
Species Specific ID: 1021

Genome

Chromosome : 7
Map Location : 7q21-q22
Ensembl : ENSG00000105810

Reagents

Labome : cdk6-antibody