DNASU Plasmid Repository • 480.965.5697 | Email

PSMD9 (Homo sapiens) in pDONR201 (Gateway donor/master vector)


Explanation of Terms

Gene: Gene Symbol:  PSMD9
Gene Name:  proteasome (prosome, macropain) 26S subunit, non-ATPase, 9
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH130083.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Discrepancy :
No / No
Publications: None
Authors: HIP

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 630nts         Open reading frame : 1 to 630


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 754
Start on reference sequence 125
5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : PSMD9
Symbol Nomenclature : PSMD9
SYNONYM : Rpn4; p27
Designation : 26S proteasome non-ATPase regulatory subunit 9|26S proteasome regulatory subunit p27|homolog of rat Bridge 1|proteasome 26S non-ATPase regulatory subunit 9
Full Nomenclature : proteasome (prosome, macropain) 26S subunit, non-ATPase, 9
GENEID : 5715
GI : 60817346
GenBank Accession : AY893382
HGNC : 9567
MIM : 603146
Vega : OTTHUMG00000168945
Target GenBank: NM_002813



Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : APC/C:Cdc20 mediated degradation of Securin
Reactome : APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : APC/C:Cdh1 mediated degradation of Cdc20 and other APC/C:Cdh1 targeted proteins in late mitosis/early G1
Reactome : AUF1 (hnRNP D0) destabilizes mRNA
Reactome : Activation of APC/C and APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : Activation of NF-kappaB in B cells
Reactome : Adaptive Immune System
Reactome : Antigen processing-Cross presentation
Reactome : Antigen processing: Ubiquitination & Proteasome degradation
Reactome : Apoptosis
Reactome : Assembly of the pre-replicative complex
Reactome : Asymmetric localization of PCP proteins
Reactome : Autodegradation of Cdh1 by Cdh1:APC/C
Reactome : Autodegradation of the E3 ubiquitin ligase COP1
Reactome : CDK-mediated phosphorylation and removal of Cdc6
Reactome : CDT1 association with the CDC6:ORC:origin complex
Reactome : Cdc20:Phospho-APC/C mediated degradation of Cyclin A
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Cross-presentation of soluble exogenous antigens (endosomes)
Reactome : Cyclin A:Cdk2-associated events at S phase entry
Reactome : Cyclin E associated events during G1/S transition
Reactome : DNA Replication
Reactome : DNA Replication Pre-Initiation
Reactome : Disease
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : ER-Phagosome pathway
Reactome : G1/S DNA Damage Checkpoints
Reactome : G1/S Transition
Reactome : Gene Expression
Reactome : HIV Infection
Reactome : Host Interactions of HIV factors
Reactome : Immune System
Reactome : M Phase
Reactome : M/G1 Transition
Reactome : Metabolism
Reactome : Metabolism of RNA
Reactome : Metabolism of amino acids and derivatives
Reactome : Metabolism of mRNA
Reactome : Mitotic Anaphase
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Metaphase and Anaphase
Reactome : Orc1 removal from chromatin
Reactome : PCP/CE pathway
Reactome : Regulation of APC/C activators between G1/S and early anaphase
Reactome : Regulation of Apoptosis
Reactome : Regulation of DNA replication
Reactome : Regulation of activated PAK-2p34 by proteasome mediated degradation
Reactome : Regulation of mRNA stability by proteins that bind AU-rich elements
Reactome : Regulation of mitotic cell cycle
Reactome : Regulation of ornithine decarboxylase (ODC)
Reactome : Removal of licensing factors from origins
Reactome : S Phase
Reactome : SCF(Skp2)-mediated degradation of p27/p21
Reactome : SCF-beta-TrCP mediated degradation of Emi1
Reactome : Separation of Sister Chromatids
Reactome : Signal Transduction
Reactome : Signaling by Wnt
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Stabilization of p53
Reactome : Switching of origins to a post-replicative state
Reactome : Synthesis of DNA
Reactome : TCF dependent signaling in response to WNT
Reactome : Ubiquitin Mediated Degradation of Phosphorylated Cdc25A
Reactome : Ubiquitin-dependent degradation of Cyclin D
Reactome : Ubiquitin-dependent degradation of Cyclin D1
Reactome : Vif-mediated degradation of APOBEC3G
Reactome : Vpu mediated degradation of CD4
Reactome : beta-catenin independent WNT signaling
Reactome : degradation of AXIN
Reactome : degradation of DVL
Reactome : p53-Dependent G1 DNA Damage Response
Reactome : p53-Dependent G1/S DNA damage checkpoint
Reactome : p53-Independent DNA Damage Response
Reactome : p53-Independent G1/S DNA damage checkpoint
WikiPathway : Proteasome Degradation


UniProt : O00233
HPRD : 04394


Cloning Information : 130083
HIP Master Clone ID : 106232
Original Clone ID : FLH130083.01X


TAX_ID : 9606
Species Specific ID: 5715


Chromosome : 12
Map Location : 12q24.31-q24.32
Ensembl : ENSG00000110801


Labome : PSMD9-antibody