DNASU Plasmid Repository • 480.965.5697 | Email

CDK4 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CDK4
Gene Name:  cyclin-dependent kinase 4
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH031046.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00001473

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 912nts        
Open reading frame : 1 to 912
Reference Sequence Alignment

ATGGCTACCTCTCGATATGAGCCAGTGGCTGAAATTGGTGTCGGTGCCTATGGGACAGTG
TACAAGGCCCGTGATCCCCACAGTGGCCACTTTGTGGCCCTCAAGAGTGTGAGAGTCCCC
AATGGAGGAGGAGGTGGAGGAGGCCTTCCCATCAGCACAGTTCGTGAGGTGGCTTTACTG
AGGCGACTGGAGGCTTTTGAGCATCCCAATGTTGTCCGGCTGATGGACGTCTGTGCCACA
TCCCGAACTGACCGGGAGATCAGGGTAACCCTGGTGTTTGAGCATGTAGACCAGGACCTA
AGGACATATCTGGACAAGGCACCCCCACCAGGCTTGCCAGCCGAAACGATCAAGGATCTG
ATGCGCCAGTTTCTAAGAGGCCTAGATTTCCTTCATGCCAATTGCATCGTTCACCGAGAT
CTGAAGCCAGAGAACATTCTGGTGACAAGTGGTGGAACAGTCAAGCTGGCTGACTTTGGC
CTGGCCAGAATCTACAGCTACCAGATGGCACTTACACCCGTGGTTGTTACACTCTGGTAC
CGAGCTCCCGAAGTTCTTCTGCAGTCCACATATGCAACACCTGTGGACATGTGGAGTGTT
GGCTGTATCTTTGCAGAGATGTTTCGTCGAAAGCCTCTCTTCTGTGGAAACTCTGAAGCC
GACCAGTTGGGCAAAATCTTTGACCTGATTGGGCTGCCTCCAGAGGATGACTGGCCTCGA
GATGTATCCCTGCCCCGTGGAGCCTTTCCCCCCAGAGGGCCCCGCCCAGTGCAGTCGGTG
GTACCTGAGATGGAGGAGTCGGGAGCACAGCTGCTGCTGGAAATGCTGACTTTTAACCCA
CACAAGCGAATCTCTGCCTTTCGAGCTCTGCAGCACTCTTATCTACATAAGGATGAAGGT
AATCCGGAGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1138
Start on reference sequence 227
Mutations:
None
Discrepancy:
a263g,K88R
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 9 42
recombination site loxP site loxP recombination site 1015 1048
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CDK4
Symbol Nomenclature : CDK4
SYNONYM : CMM3; PSK-J3
Designation : cell division protein kinase 4
Full Nomenclature : cyclin-dependent kinase 4
GENEID : 1019
GI : 61368652
GenBank Accession : AY891289
HGNC : 1773
MIM : 123829
Vega : OTTHUMG00000170382
Target GenBank: NM_000075

 

Reference Sequence Alignment

  

HsCD00001473      ATGGCTACCTCTCGATATGAGCCAGTGGCTGAAATTGGTGTCGGTGCCTATGGGACAGTG
NM_000075.3       ATGGCTACCTCTCGATATGAGCCAGTGGCTGAAATTGGTGTCGGTGCCTATGGGACAGTG
                  ************************************************************

HsCD00001473      TACAAGGCCCGTGATCCCCACAGTGGCCACTTTGTGGCCCTCAAGAGTGTGAGAGTCCCC
NM_000075.3       TACAAGGCCCGTGATCCCCACAGTGGCCACTTTGTGGCCCTCAAGAGTGTGAGAGTCCCC
                  ************************************************************

HsCD00001473      AATGGAGGAGGAGGTGGAGGAGGCCTTCCCATCAGCACAGTTCGTGAGGTGGCTTTACTG
NM_000075.3       AATGGAGGAGGAGGTGGAGGAGGCCTTCCCATCAGCACAGTTCGTGAGGTGGCTTTACTG
                  ************************************************************

HsCD00001473      AGGCGACTGGAGGCTTTTGAGCATCCCAATGTTGTCCGGCTGATGGACGTCTGTGCCACA
NM_000075.3       AGGCGACTGGAGGCTTTTGAGCATCCCAATGTTGTCCGGCTGATGGACGTCTGTGCCACA
                  ************************************************************

HsCD00001473      TCCCGAACTGACCGGGAGATCAGGGTAACCCTGGTGTTTGAGCATGTAGACCAGGACCTA
NM_000075.3       TCCCGAACTGACCGGGAGATCAAGGTAACCCTGGTGTTTGAGCATGTAGACCAGGACCTA
                  **********************.*************************************

HsCD00001473      AGGACATATCTGGACAAGGCACCCCCACCAGGCTTGCCAGCCGAAACGATCAAGGATCTG
NM_000075.3       AGGACATATCTGGACAAGGCACCCCCACCAGGCTTGCCAGCCGAAACGATCAAGGATCTG
                  ************************************************************

HsCD00001473      ATGCGCCAGTTTCTAAGAGGCCTAGATTTCCTTCATGCCAATTGCATCGTTCACCGAGAT
NM_000075.3       ATGCGCCAGTTTCTAAGAGGCCTAGATTTCCTTCATGCCAATTGCATCGTTCACCGAGAT
                  ************************************************************

HsCD00001473      CTGAAGCCAGAGAACATTCTGGTGACAAGTGGTGGAACAGTCAAGCTGGCTGACTTTGGC
NM_000075.3       CTGAAGCCAGAGAACATTCTGGTGACAAGTGGTGGAACAGTCAAGCTGGCTGACTTTGGC
                  ************************************************************

HsCD00001473      CTGGCCAGAATCTACAGCTACCAGATGGCACTTACACCCGTGGTTGTTACACTCTGGTAC
NM_000075.3       CTGGCCAGAATCTACAGCTACCAGATGGCACTTACACCCGTGGTTGTTACACTCTGGTAC
                  ************************************************************

HsCD00001473      CGAGCTCCCGAAGTTCTTCTGCAGTCCACATATGCAACACCTGTGGACATGTGGAGTGTT
NM_000075.3       CGAGCTCCCGAAGTTCTTCTGCAGTCCACATATGCAACACCTGTGGACATGTGGAGTGTT
                  ************************************************************

HsCD00001473      GGCTGTATCTTTGCAGAGATGTTTCGTCGAAAGCCTCTCTTCTGTGGAAACTCTGAAGCC
NM_000075.3       GGCTGTATCTTTGCAGAGATGTTTCGTCGAAAGCCTCTCTTCTGTGGAAACTCTGAAGCC
                  ************************************************************

HsCD00001473      GACCAGTTGGGCAAAATCTTTGACCTGATTGGGCTGCCTCCAGAGGATGACTGGCCTCGA
NM_000075.3       GACCAGTTGGGCAAAATCTTTGACCTGATTGGGCTGCCTCCAGAGGATGACTGGCCTCGA
                  ************************************************************

HsCD00001473      GATGTATCCCTGCCCCGTGGAGCCTTTCCCCCCAGAGGGCCCCGCCCAGTGCAGTCGGTG
NM_000075.3       GATGTATCCCTGCCCCGTGGAGCCTTTCCCCCCAGAGGGCCCCGCCCAGTGCAGTCGGTG
                  ************************************************************

HsCD00001473      GTACCTGAGATGGAGGAGTCGGGAGCACAGCTGCTGCTGGAAATGCTGACTTTTAACCCA
NM_000075.3       GTACCTGAGATGGAGGAGTCGGGAGCACAGCTGCTGCTGGAAATGCTGACTTTTAACCCA
                  ************************************************************

HsCD00001473      CACAAGCGAATCTCTGCCTTTCGAGCTCTGCAGCACTCTTATCTACATAAGGATGAAGGT
NM_000075.3       CACAAGCGAATCTCTGCCTTTCGAGCTCTGCAGCACTCTTATCTACATAAGGATGAAGGT
                  ************************************************************

HsCD00001473      AATCCGGAGTTG
NM_000075.3       AATCCGGAGTGA
                  ********** .

Pathways

NCI : ATF-2 transcription factor network
NCI : Calcineurin-regulated NFAT-dependent transcription in lymphocytes
NCI : FOXM1 transcription factor network
NCI : Regulation of nuclear SMAD2/3 signaling
NCI : Regulation of retinoblastoma protein
NCI : Validated targets of C-MYC transcriptional activation
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cellular responses to stress
Reactome : Cellular Senescence
Reactome : Cyclin D associated events in G1
Reactome : Developmental Biology
Reactome : G1 Phase
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Mitotic G1-G1/S phases
Reactome : Oncogene Induced Senescence
Reactome : Oxidative Stress Induced Senescence
Reactome : S Phase
Reactome : Senescence-Associated Secretory Phenotype (SASP)
Reactome : Transcriptional regulation of white adipocyte differentiation
Reactome : Ubiquitin-dependent degradation of Cyclin D
Reactome : Ubiquitin-dependent degradation of Cyclin D1
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : G1 to S cell cycle control
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : Ovarian Infertility Genes
WikiPathway : TSH signaling pathway

Clone

Cloning Information : 31046
HIP Master Clone ID : 61422
Original Clone ID : FLH031046.01L

Organism


TAX_ID : 9606
Species Specific ID: 1019

Genome

Chromosome : 12
Map Location : 12q14
Ensembl : ENSG00000135446

Reagents

Labome : Cdk4-antibody