DNASU Plasmid Repository • 480.965.5697 | Email

MYC (Homo sapiens) in pDONR201 (Gateway donor/master vector)


Explanation of Terms

Gene: Gene Symbol:  MYC
Gene Name:  v-myc avian myelocytomatosis viral oncogene homolog
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH054033.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Discrepancy :
No / No
Publications: None
Authors: HIP

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 1320nts        
Open reading frame : 1 to 1320
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1878
Start on reference sequence 559
5' Linker Sequence: None
3' Linker Sequence: None


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : MYC
Symbol Nomenclature : MYC
Designation : avian myelocytomatosis viral oncogene homolog|cMyc|class E basic helix-loop-helix protein 39|myc proto-oncogene protein|myc-related translation/localization regulatory factor|proto-oncogene c-Myc|transcription factor p64|v-myc myelocytomatosis viral oncogene homolog
Full Nomenclature : v-myc avian myelocytomatosis viral oncogene homolog
GENEID : 4609
GI : 60817571
GenBank Accession : AY893392
HGNC : 7553
MIM : 190080
Vega : OTTHUMG00000128475
Target GenBank: NM_002467


Reference Sequence Alignment


HsCD00001502      ---------------------------------------------ATGCCCCTCAACGTT
























NCI : AP-1 transcription factor network
NCI : C-MYB transcription factor network
NCI : C-MYC pathway
NCI : CD40/CD40L signaling
NCI : Ceramide signaling pathway
NCI : E2F transcription factor network
NCI : FOXM1 transcription factor network
NCI : IL2 signaling events mediated by PI3K
NCI : IL2 signaling events mediated by STAT5
NCI : IL2-mediated signaling events
NCI : IL6-mediated signaling events
NCI : LKB1 signaling events
NCI : Notch signaling pathway
NCI : p73 transcription factor network
NCI : PDGFR-beta signaling pathway
NCI : Presenilin action in Notch and Wnt signaling
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Regulation of nuclear SMAD2/3 signaling
NCI : Regulation of Telomerase
NCI : Validated nuclear estrogen receptor alpha network
NCI : Validated targets of C-MYC transcriptional activation
NCI : Validated targets of C-MYC transcriptional repression
Panther : Interleukin signaling pathway
Panther : Oxidative stress response
Panther : p53 pathway feedback loops 2
Panther : PDGF signaling pathway
Panther : Wnt signaling pathway
Reactome : binding of TCF/LEF:CTNNB1 to target gene promoters
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Constitutive Signaling by NOTCH1 HD+PEST Domain Mutants
Reactome : Constitutive Signaling by NOTCH1 PEST Domain Mutants
Reactome : Cyclin A:Cdk2-associated events at S phase entry
Reactome : Cyclin E associated events during G1/S transition
Reactome : Disease
Reactome : FBXW7 Mutants and NOTCH1 in Cancer
Reactome : formation of the beta-catenin:TCF transactivating complex
Reactome : G1/S Transition
Reactome : Gene Expression
Reactome : Generic Transcription Pathway
Reactome : Insulin-like Growth Factor-2 mRNA Binding Proteins (IGF2BPs/IMPs/VICKZs) bind RNA
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : Mitotic G1-G1/S phases
Reactome : NOTCH1 Intracellular Domain Regulates Transcription
Reactome : S Phase
Reactome : Signal Transduction
Reactome : Signaling by NOTCH
Reactome : Signaling by NOTCH1
Reactome : Signaling by NOTCH1 HD Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 HD+PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 in Cancer
Reactome : Signaling by NOTCH1 PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 t(7;9)(NOTCH1:M1580_K2555) Translocation Mutant
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : Signaling by Wnt
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD2/SMAD3:SMAD4 heterotrimer regulates transcription
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : TCF dependent signaling in response to WNT
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer
Reactome : Transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer
WikiPathway : Apoptosis
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : DNA damage response
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : E2F/MIRHG1 feedback-loop
WikiPathway : ErbB signaling pathway
WikiPathway : G1 to S cell cycle control
WikiPathway : IL-2 Signaling pathway
WikiPathway : IL-5 signaling pathway
WikiPathway : IL-7 signaling pathway
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : MAPK signaling pathway
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : miRNAs involved in DDR
WikiPathway : Neural Crest Differentiation
WikiPathway : Notch Signaling Pathway
WikiPathway : p38 MAPK Signaling Pathway
WikiPathway : Prolactin Signaling Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TP53 network
WikiPathway : TSH signaling pathway
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency


SMART domain : HLH : helix loop helix domain
UniProt : P01106
HPRD : 01818


Cloning Information : 54033
HIP Master Clone ID : 10294
Original Clone ID : FLH054033.01X


TAX_ID : 9606
Species Specific ID: 4609


Chromosome : 8
Map Location : 8q24.21
Ensembl : ENSG00000136997


Labome : c-Myc-antibody