DNASU Plasmid Repository • 480.965.5697 | Email

NFYC (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NFYC
Gene Name:  nuclear transcription factor Y, gamma
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH010203.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00001542

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1008nts         Open reading frame : 1 to 1008
Reference Sequence Alignment

ATGTCCACAGAAGGAGGATTTGGTGGTACTAGCAGCAGTGATGCCCAGCAAAGCCTACAG
TCGTTCTGGCCTCGGGTCATGGAAGAAATCCGGAATTTAACAGTGAAAGACTTCCGAGTG
CAGGAACTCCCACTGGCTCGTATTAAGAAGATTATGAAACTGGATGAAGATGTGAAGATG
ATCAGTGCAGAAGCGCCTGTACTCTTTGCCAAGGCAGCCCAGATTTTTATCACAGAGTTG
ACTCTTCGAGCCTGGATTCACACAGAAGATAACAAGCGCCGGACTCTACAGAGAAATGAT
ATCGCCATGGCAATTACAAAATTTGATCAGTTTGATTTTCTCATCGATATTGTTCCAAGA
GATGAACTGAAACCTCCAAAGCGTCAGGAGGAGGTGCGCCAGTCTGTAACTCCTGCCGAG
CCAGTCCAGTACTATTTCACGCTGGCTCAGCAACCCACCGCTGTCCAAGTTCAGGGCCAG
CAGCAAGGCCAGCAGACCACCAGCTCCACGACCACCATCCAGCCTGGGCAGATCATCATC
GCACAGCCTCAGCAGGGCCAGACCACACCTGTGACAATGCAGGTTGGAGAAGGTCAGCAG
GTGCAGATTGTCCAGGCTCAGCCACAGGGTCAAGCCCAACAGGCCCAGAGTGGCACTGGA
CAGACCATGCAGGTGATGCAGCAGATCATCACTAACACAGGAGAGATCCAGCAGATCCCG
GTGCAGCTGAATGCCGGCCAGCTGCAGTATATCCGCTTAGCCCAGCCTGTATCAGGCACT
CAAGTTGTGCAGGGACAGATCCAGACACTTGCCACCAATGCTCAACAGATTACACAGACA
GAGGTCCAGCAAGGACAGCAGCAGTTCAGCCAGTTCACAGATGGACAGCAGCTCTACCAG
ATCCAGCAAGTCACCATGCCTGCGGGCCAGGACCTCGCCCAGCCCATGTTCATCCAGTCA
GCCAACCAGCCCTCCGACGGGCAGGCCCCCCAGGTGACCGGCGACTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1193
Start on reference sequence 186
Mutations:
None
Discrepancy:
c471t
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NFYC
Symbol Nomenclature : NFYC
SYNONYM : CBF-C; CBFC; H1TF2A; HAP5; HSM; NF-YC
Designation : CAAT box DNA-binding protein subunit C|CCAAT binding factor subunit C|CCAAT transcription binding factor subunit gamma|histone H1 transcription factor large subunit 2A|nuclear transcription factor Y subunit C|nuclear transcription factor Y subunit gamma|transactivator HSM-1|transactivator HSM-1/2|transcription factor NF-Y, C subunit
Full Nomenclature : nuclear transcription factor Y, gamma
GENEID : 4802
Locus Tag : RP5-1066H13.1
GI : 61358718
GenBank Accession : AY888670
HGNC : 7806
MIM : 605344
Vega : OTTHUMG00000007729
Target GenBank: NM_014223

 

Reference Sequence Alignment

  

HsCD00001542        ATGTCCACAGAAGGAGGATTTGGTGGTACTAGCAGCAGTGATGCCCAGCAAAGCCTACAG
NM_014223.4         ATGTCCACAGAAGGAGGATTTGGTGGTACTAGCAGCAGTGATGCCCAGCAAAGCCTACAG
XM_005270894.1      ATGTCCACAGAAGGAGGATTTGGTGGTACTAGCAGCAGTGATGCCCAGCAAAGCCTACAG
XM_005270896.1      ATGTCCACAGAAGGAGGATTTGGTGGTACTAGCAGCAGTGATGCCCAGCAAAGCCTACAG
NM_001142588.1      ATGTCCACAGAAGGAGGATTTGGTGGTACTAGCAGCAGTGATGCCCAGCAAAGCCTACAG
NM_001142587.1      ATGTCCACAGAAGGAGGATTTGGTGGTACTAGCAGCAGTGATGCCCAGCAAAGCCTACAG
XM_005270893.1      ATGTCCACAGAAGGAGGATTTGGTGGTACTAGCAGCAGTGATGCCCAGCAAAGCCTACAG
                    ************************************************************

HsCD00001542        TCGTTCTGGCCTCGGGTCATGGAAGAAATCCGGAATTTAACAGTGAAAGACTTCCGAGTG
NM_014223.4         TCGTTCTGGCCTCGGGTCATGGAAGAAATCCGGAATTTAACAGTGAAAGACTTCCGAGTG
XM_005270894.1      TCGTTCTGGCCTCGGGTCATGGAAGAAATCCGGAATTTAACAGTGAAAGACTTCCGAGTG
XM_005270896.1      TCGTTCTGGCCTCGGGTCATGGAAGAAATCCGGAATTTAACAGTGAAAGACTTCCGAGTG
NM_001142588.1      TCGTTCTGGCCTCGGGTCATGGAAGAAATCCGGAATTTAACAGTGAAAGACTTCCGAGTG
NM_001142587.1      TCGTTCTGGCCTCGGGTCATGGAAGAAATCCGGAATTTAACAGTGAAAGACTTCCGAGTG
XM_005270893.1      TCGTTCTGGCCTCGGGTCATGGAAGAAATCCGGAATTTAACAGTGAAAGACTTCCGAGTG
                    ************************************************************

HsCD00001542        CAGGAACTCCCACTGGCTCGTATTAAGAAGATTATGAAACTGGATGAAGATGTGAAGATG
NM_014223.4         CAGGAACTCCCACTGGCTCGTATTAAGAAGATTATGAAACTGGATGAAGATGTGAAGATG
XM_005270894.1      CAGGAACTCCCACTGGCTCGTATTAAGAAGATTATGAAACTGGATGAAGATGTGAAGATG
XM_005270896.1      CAGGAACTCCCACTGGCTCGTATTAAGAAGATTATGAAACTGGATGAAGATGTGAAGATG
NM_001142588.1      CAGGAACTCCCACTGGCTCGTATTAAGAAGATTATGAAACTGGATGAAGATGTGAAGATG
NM_001142587.1      CAGGAACTCCCACTGGCTCGTATTAAGAAGATTATGAAACTGGATGAAGATGTGAAGATG
XM_005270893.1      CAGGAACTCCCACTGGCTCGTATTAAGAAGATTATGAAACTGGATGAAGATGTGAAGATG
                    ************************************************************

HsCD00001542        ATCAGTGCAGAAGCGCCTGTACTCTTTGCCAAGGCAGCCCAGATTTTTATCACAGAGTTG
NM_014223.4         ATCAGTGCAGAAGCGCCTGTACTCTTTGCCAAGGCAGCCCAGATTTTTATCACAGAGTTG
XM_005270894.1      ATCAGTGCAGAAGCGCCTGTACTCTTTGCCAAGGCAGCCCAGATTTTTATCACAGAGTTG
XM_005270896.1      ATCAGTGCAGAAGCGCCTGTACTCTTTGCCAAGGCAGCCCAGATTTTTATCACAGAGTTG
NM_001142588.1      ATCAGTGCAGAAGCGCCTGTACTCTTTGCCAAGGCAGCCCAGATTTTTATCACAGAGTTG
NM_001142587.1      ATCAGTGCAGAAGCGCCTGTACTCTTTGCCAAGGCAGCCCAGATTTTTATCACAGAGTTG
XM_005270893.1      ATCAGTGCAGAAGCGCCTGTACTCTTTGCCAAGGCAGCCCAGATTTTTATCACAGAGTTG
                    ************************************************************

HsCD00001542        ACTCTTCGAGCCTGGATTCACACAGAAGATAACAAGCGCCGGACTCTACAGAGAAATGAT
NM_014223.4         ACTCTTCGAGCCTGGATTCACACAGAAGATAACAAGCGCCGGACTCTACAGAGAAATGAT
XM_005270894.1      ACTCTTCGAGCCTGGATTCACACAGAAGATAACAAGCGCCGGACTCTACAGAGAAATGAT
XM_005270896.1      ACTCTTCGAGCCTGGATTCACACAGAAGATAACAAGCGCCGGACTCTACAGAGAAATGAT
NM_001142588.1      ACTCTTCGAGCCTGGATTCACACAGAAGATAACAAGCGCCGGACTCTACAGAGAAATGAT
NM_001142587.1      ACTCTTCGAGCCTGGATTCACACAGAAGATAACAAGCGCCGGACTCTACAGAGAAATGAT
XM_005270893.1      ACTCTTCGAGCCTGGATTCACACAGAAGATAACAAGCGCCGGACTCTACAGAGAAATGAT
                    ************************************************************

HsCD00001542        ATCGCCATGGCAATTACAAAATTTGATCAGTTTGATTTTCTCATCGATATTGTTCCAAGA
NM_014223.4         ATCGCCATGGCAATTACAAAATTTGATCAGTTTGATTTTCTCATCGATATTGTTCCAAGA
XM_005270894.1      ATCGCCATGGCAATTACAAAATTTGATCAGTTTGATTTTCTCATCGATATTGTTCCAAGA
XM_005270896.1      ATCGCCATGGCAATTACAAAATTTGATCAGTTTGATTTTCTCATCGATATTGTTCCAAGA
NM_001142588.1      ATCGCCATGGCAATTACAAAATTTGATCAGTTTGATTTTCTCATCGATATTGTTCCAAGA
NM_001142587.1      ATCGCCATGGCAATTACAAAATTTGATCAGTTTGATTTTCTCATCGATATTGTTCCAAGA
XM_005270893.1      ATCGCCATGGCAATTACAAAATTTGATCAGTTTGATTTTCTCATCGATATTGTTCCAAGA
                    ************************************************************

HsCD00001542        GATGAACTGAAACCTCCAAAGCGTCAGGAGGAGGTGCGCCAGTCTGTAACTCCTGCCGAG
NM_014223.4         GATGAACTGAAACCTCCAAAGCGTCAGGAGGAGGTGCGCCAGTCTGTAACTCCTGCCGAG
XM_005270894.1      GATGAACTGAAACCTCCAAAGCGTCAGGAGGAGGTGCGCCAGTCTGTAACTCCTGCCGAG
XM_005270896.1      GATGAACTGAAACCTCCAAAGCGTCAGGAGGAGGTGCGCCAGTCTGTAACTCCTGCCGAG
NM_001142588.1      GATGAACTGAAACCTCCAAAGCGTCAGGAGGAGGTGCGCCAGTCTGTAACTCCTGCCGAG
NM_001142587.1      GATGAACTGAAACCTCCAAAGCGTCAGGAGGAGGTGCGCCAGTCTGTAACTCCTGCCGAG
XM_005270893.1      GATGAACTGAAACCTCCAAAGCGTCAGGAGGAGGTGCGCCAGTCTGTAACTCCTGCCGAG
                    ************************************************************

HsCD00001542        CCAGTCCAGTACTATTTCACGCTGGCTCAGCAACCCACCGCTGTCCAAGTTCAGGGCCAG
NM_014223.4         CCAGTCCAGTACTATTTCACGCTGGCTCAGCAACCCACCGCTGTCCAAGTCCAGGGCCAG
XM_005270894.1      CCAGTCCAGTACTATTTCACGCTGGCTCAGCAACCCACCGCTGTCCAAGTCCAGGGCCAG
XM_005270896.1      CCAGTCCAGTACTATTTCACGCTGGCTCAGCAACCCACCGCTGTCCAAGTCCAGGGCCAG
NM_001142588.1      CCAGTCCAGTACTATTTCACGCTGGCTCAGCAACCCACCGCTGTCCAAGTCCAGGGCCAG
NM_001142587.1      CCAGTCCAGTACTATTTCACGCTGGCTCAGCAACCCACCGCTGTCCAAGTCCAGGGCCAG
XM_005270893.1      CCAGTCCAGTACTATTTCACGCTGGCTCAGCAACCCACCGCTGTCCAAGTCCAGGGCCAG
                    ************************************************** *********

HsCD00001542        CAGCAAGGCCAGCAGACCACCAGCTCCACGACCACCATCCAGCCTGGGCAGATCATCATC
NM_014223.4         CAGCAAGGCCAGCAGACCACCAGCTCCACGACCACCATCCAGCCTGGGCAGATCATCATC
XM_005270894.1      CAGCAAGGCCAGCAGACCACCAGCTCCACGACCACCATCCAGCCTGGGCAGATCATCATC
XM_005270896.1      CAGCAAGGCCAGCAGACCACCAGCTCCACGACCACCATCCAGCCTGGGCAGATCATCATC
NM_001142588.1      CAGCAAGGCCAGCAGACCACCAGCTCCACGACCACCATCCAGCCTGGGCAGATCATCATC
NM_001142587.1      CAGCAAGGCCAGCAGACCACCAGCTCCACGACCACCATCCAGCCTGGGCAGATCATCATC
XM_005270893.1      CAGCAAGGCCAGCAGACCACCAGCTCCACGACCACCATCCAGCCTGGGCAGATCATCATC
                    ************************************************************

HsCD00001542        GCACAGCCTCAGCAGGGCCAGACCACACCTGTGACAATGCAGGTTGGAGAAGGTCAGCAG
NM_014223.4         GCACAGCCTCAGCAGGGCCAGACCACACCTGTGACAATGCAGGTTGGAGAAGGTCAGCAG
XM_005270894.1      GCACAGCCTCAGCAGGGCCAGACCACACCTGTGACAATGCAGGTTGGAGAAGGTCAGCAG
XM_005270896.1      GCACAGCCTCAGCAGGGCCAGACCACACCTGTGACAATGCAGGTTGGAGAAGGTCAGCAG
NM_001142588.1      GCACAGCCTCAGCAGGGCCAGACCACACCTGTGACAATGCAGGTTGGAGAAGGTCAGCAG
NM_001142587.1      GCACAGCCTCAGCAGGGCCAGACCACACCTGTGACAATGCAGGTTGGAGAAGGTCAGCAG
XM_005270893.1      GCACAGCCTCAGCAGGGCCAGACCACACCTGTGACAATGCAGGTTGGAGAAGGTCAGCAG
                    ************************************************************

HsCD00001542        GTGCAGATTGTCCAGGCTCAGCCACAGGGTCAAGCCCAACAGGCCCAGAGTGGCACTGGA
NM_014223.4         GTGCAGATTGTCCAGGCTCAGCCACAGGGTCAAGCCCAACAGGCCCAGAGTGGCACTGGA
XM_005270894.1      GTGCAGATTGTCCAGGCTCAGCCACAGGGTCAAGCCCAACAGGCCCAGAGTGGCACTGGA
XM_005270896.1      GTGCAGATTGTCCAGGCTCAGCCACAGGGTCAAGCCCAACAGGCCCAGAGTGGCACTGGA
NM_001142588.1      GTGCAGATTGTCCAGGCTCAGCCACAGGGTCAAGCCCAACAGGCCCAGAGTGGCACTGGA
NM_001142587.1      GTGCAGATTGTCCAGGCTCAGCCACAGGGTCAAGCCCAACAGGCCCAGAGTGGCACTGGA
XM_005270893.1      GTGCAGATTGTCCAGGCTCAGCCACAGGGTCAAGCCCAACAGGCCCAGAGTGGCACTGGA
                    ************************************************************

HsCD00001542        CAGACCATGCAGGTGATGCAGCAGATCATCACTAACACAGGAGAGATCCAGCAGATCCCG
NM_014223.4         CAGACCATGCAGGTGATGCAGCAGATCATCACTAACACAGGAGAGATCCAGCAGATCCCG
XM_005270894.1      CAGACCATGCAGGTGATGCAGCAGATCATCACTAACACAGGAGAGATCCAGCAGATCCCG
XM_005270896.1      CAGACCATGCAGGTGATGCAGCAGATCATCACTAACACAGGAGAGATCCAGCAGATCCCG
NM_001142588.1      CAGACCATGCAGGTGATGCAGCAGATCATCACTAACACAGGAGAGATCCAGCAGATCCCG
NM_001142587.1      CAGACCATGCAGGTGATGCAGCAGATCATCACTAACACAGGAGAGATCCAGCAGATCCCG
XM_005270893.1      CAGACCATGCAGGTGATGCAGCAGATCATCACTAACACAGGAGAGATCCAGCAGATCCCG
                    ************************************************************

HsCD00001542        GTGCAGCTGAATGCCGGCCAGCTGCAGTATATCCGCTTAGCCCAGCCTGTATCAGGCACT
NM_014223.4         GTGCAGCTGAATGCCGGCCAGCTGCAGTATATCCGCTTAGCCCAGCCTGTATCAGGCACT
XM_005270894.1      GTGCAGCTGAATGCCGGCCAGCTGCAGTATATCCGCTTAGCCCAGCCTGTATCAGGCACT
XM_005270896.1      GTGCAGCTGAATGCCGGCCAGCTGCAGTATATCCGCTTAGCCCAGCCTGTATCAGGCACT
NM_001142588.1      GTGCAGCTGAATGCCGGCCAGCTGCAGTATATCCGCTTAGCCCAGCCTGTATCAGGCACT
NM_001142587.1      GTGCAGCTGAATGCCGGCCAGCTGCAGTATATCCGCTTAGCCCAGCCTGTATCAGGCACT
XM_005270893.1      GTGCAGCTGAATGCCGGCCAGCTGCAGTATATCCGCTTAGCCCAGCCTGTATCAGGCACT
                    ************************************************************

HsCD00001542        CAAGTTGTGCAGGGACAGATCCAGACACTTGCCACCAATGCTCAACAG------------
NM_014223.4         CAAGTTGTGCAGGGACAGATCCAGACACTTGCCACCAATGCTCAACAG------------
XM_005270894.1      CAAGTTGTGCAGGGACAGATCCAGACACTTGCCACCAATGCTCAACAGGGGCAAAGAAAT
XM_005270896.1      CAAGTTGTGCAGGGACAGATCCAGACACTTGCCACCAATGCTCAACAG------------
NM_001142588.1      CAAGTTGTGCAGGGACAGATCCAGACACTTGCCACCAATGCTCAACAGGGGCAAAGAAAT
NM_001142587.1      CAAGTTGTGCAGGGACAGATCCAGACACTTGCCACCAATGCTCAACAG------------
XM_005270893.1      CAAGTTGTGCAGGGACAGATCCAGACACTTGCCACCAATGCTCAACAGGGGCAAAGAAAT
                    ************************************************            

HsCD00001542        ---------------------------------------------ATTACACAGACAGAG
NM_014223.4         ---------------------------------------------ATTACACAGACAGAG
XM_005270894.1      GCAAGTCAGGGGAAGCCTCGAAGGTGCCTGAAAGAAACCTTACAGATTACACAGACAGAG
XM_005270896.1      ---------------------------------------------ATTACACAGACAGAG
NM_001142588.1      GCAAGTCAGGGGAAGCCTCGAAGGTGCCTGAAAGAAACCTTACAGATTACACAGACAGAG
NM_001142587.1      ---------------------------------------------ATTACACAGACAGAG
XM_005270893.1      GCAAGTCAGGGGAAGCCTCGAAGGTGCCTGAAAGAAACCTTACAGATTACACAGACAGAG
                                                                 ***************

HsCD00001542        GTCCAGCAAGGACAGCAGCAGTTCAGCCAGTTCACAGATGGACAGCAGCTCT--------
NM_014223.4         GTCCAGCAAGGACAGCAGCAGTTCAGCCAGTTCACAGATGGACAGCAGCTCT--------
XM_005270894.1      GTCCAGCAAGGACAGCAGCAGTTCAGCCAGTTCACAGATGGACAGAGGAACAGCGTGCAG
XM_005270896.1      GTCCAGCAAGGACAGCAGCAGTTCAGCCAGTTCACAGATGGACAGAGGAACAGCGTGCAG
NM_001142588.1      GTCCAGCAAGGACAGCAGCAGTTCAGCCAGTTCACAGATGGACAGCAGCTCT--------
NM_001142587.1      GTCCAGCAAGGACAGCAGCAGTTCAGCCAGTTCACAGATG---GACAGCTCT--------
XM_005270893.1      GTCCAGCAAGGACAGCAGCAGTTCAGCCAGTTCACAGATGGACAGAGGAACAGCGTGCAG
                    ****************************************   ....*.:*:        

HsCD00001542        ------------------------------------------------------------
NM_014223.4         ------------------------------------------------------------
XM_005270894.1      CAAGCTCGAGTCTCTGAGCTAACGGGAGAGGCAGAGCCCAGAGAAGTGAAAGCCACAGGA
XM_005270896.1      CAAGCTCGAGTCTCTGAGCTAACGGGAGAGGCAGAGCCCAGAGAAGTGAAAGCCACAGGA
NM_001142588.1      ------------------------------------------------------------
NM_001142587.1      ------------------------------------------------------------
XM_005270893.1      CAAGCTCGAGTCTCTGAGCTAACGGGAGAGGCAGAGCCCAGAGAAGTGAAAGCCACAGGA
                                                                                

HsCD00001542        ------------------------------------------------------------
NM_014223.4         ------------------------------------------------------------
XM_005270894.1      AATTCAACTCCCTGCACCTCTTCCCTGCCCACCACACACCCCCCCTCACACCGGGCTGGT
XM_005270896.1      AATTCAACTCCCTGCACCTCTTCCCTGCCCACCACACACCCCCCCTCACACCGGGCTGGT
NM_001142588.1      ------------------------------------------------------------
NM_001142587.1      ------------------------------------------------------------
XM_005270893.1      AATTCAACTCCCTGCACCTCTTCCCTGCCCACCACACACCCCCCCTCACACCGGGCTGGT
                                                                                

HsCD00001542        ------------------------------------------------------------
NM_014223.4         ------------------------------------------------------------
XM_005270894.1      GCCTCCTGTGTCTGCTGCTCCCAACCCCAGCAGAGCTCCACTTCCCCTCCTCCTTCTGAC
XM_005270896.1      GCCTCCTGTGTCTGCTGCTCCCAACCCCAGCAGAGCTCCACTTCCCCTCCTCCTTCTGAC
NM_001142588.1      ------------------------------------------------------------
NM_001142587.1      ------------------------------------------------------------
XM_005270893.1      GCCTCCTGTGTCTGCTGCTCCCAACCCCAGCAGAGCTCCACTTCCCCTCCTCCTTCTGAC
                                                                                

HsCD00001542        ------------------------------------------------------------
NM_014223.4         ------------------------------------------------------------
XM_005270894.1      GCCTTGCAGTGGGTGGTGGTTGAGGTATCTGGGACCCCCAACCAGCTCGAGACCCATAGG
XM_005270896.1      GCCTTGCAGTGGGTGGTGGTTGAGGTATCTGGGACCCCCAACCAGCTCGAGACCCATAGG
NM_001142588.1      ------------------------------------------------------------
NM_001142587.1      ------------------------------------------------------------
XM_005270893.1      GCCTTGCAGTGGGTGGTGGTTGAGGTATCTGGGACCCCCAACCAGCTCGAGACCCATAGG
                                                                                

HsCD00001542        ------------------------------------------------------------
NM_014223.4         ------------------------------------------------------------
XM_005270894.1      GAGCTGCATGCCCCTCTCCCAGGGATGACCTCACTCTCTCCTCTCCACCCCTCGCAGCAG
XM_005270896.1      GAGCTGCATGCCCCTCTCCCAGGGATGACCTCACTCTCTCCTCTCCACCCCTCGCAGCAG
NM_001142588.1      ------------------------------------------------------------
NM_001142587.1      ------------------------------------------------------------
XM_005270893.1      GAGCTGCATGCCCCTCTCCCAGGGATGACCTCACTCTCTCCTCTCCACCCCTCGCAGCAG
                                                                                

HsCD00001542        ----ACCAGATCCAGCAAGTCACCATGCCTGCGGGCCAGGACCTCGCCCAGCCCATGTTC
NM_014223.4         ----ACCAGATCCAGCAAGTCACCATGCCTGCGGGCCAGGACCTCGCCCAGCCCATGTTC
XM_005270894.1      CTCTACCAGATCCAGCAAGTCACCATGCCTGCGGGCCAGGACCTCGCCCAGCCCATGTTC
XM_005270896.1      CTCTACCAGATCCAGCAAGTCACCATGCCTGCGGGCCAGGACCTCGCCCAGCCCATGTTC
NM_001142588.1      ----ACCAGATCCAGCAAGTCACCATGCCTGCGGGCCAGGACCTCGCCCAGCCCATGTTC
NM_001142587.1      ----ACCAGATCCAGCAAGTCACCATGCCTGCGGGCCAGGACCTCGCCCAGCCCATGTTC
XM_005270893.1      CTCTACCAGATCCAGCAAGTCACCATGCCTGCGGGCCAGGACCTCGCCCAGCCCATGTTC
                        ********************************************************

HsCD00001542        ATCCAGTCAGCCAACCAGCCCTCCGACGGGCAGGCCCCCCAGGTGACCGGCGACTAG
NM_014223.4         ATCCAGTCAGCCAACCAGCCCTCCGACGGGCAGGCCCCCCAGGTGACCGGCGACTGA
XM_005270894.1      ATCCAGTCAGCCAACCAGCCCTCCGACGGGCAGGCCCCCCAGGTGACCGGCGACTGA
XM_005270896.1      ATCCAGTCAGCCAACCAGCCCTCCGACGGGCAGGCCCCCCAGGTGACCGGCGACTGA
NM_001142588.1      ATCCAGTCAGCCAACCAGCCCTCCGACGGGCAGGCCCCCCAGGTGACCGGCGACTGA
NM_001142587.1      ATCCAGTCAGCCAACCAGCCCTCCGACGGGCAGGCCCCCCAGGTGACCGGCGACTGA
XM_005270893.1      ATCCAGTCAGCCAACCAGCCCTCCGACGGGCAGGCCCCCCAGGTGACCGGCGACTGA
                    *******************************************************..

Pathways

NCI : Direct p53 effectors
NCI : Validated targets of C-MYC transcriptional repression
Reactome : ATF4 activates genes
Reactome : ATF6-alpha activates chaperone genes
Reactome : ATF6-alpha activates chaperones
Reactome : Activation of gene expression by SREBF (SREBP)
Reactome : Fatty acid, triacylglycerol, and ketone body metabolism
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Metabolism of proteins
Reactome : PERK regulates gene expression
Reactome : PPARA activates gene expression
Reactome : Regulation of cholesterol biosynthesis by SREBP (SREBF)
Reactome : Regulation of lipid metabolism by Peroxisome proliferator-activated receptor alpha (PPARalpha)
Reactome : Unfolded Protein Response (UPR)

Protein

UniProt : Q13952
UniProt : B4DW63
UniProt : Q59GY4
UniProt : Q5T6K9
UniProt : B4DUS6

Clone

Cloning Information : 10203
HIP Master Clone ID : 14265
Original Clone ID : FLH010203.01X

Organism


TAX_ID : 9606
Species Specific ID: 4802

Genome

Chromosome : 1
Map Location : 1p32
Ensembl : ENSG00000066136

Reagents

Labome : NFYC-antibody