DNASU Plasmid Repository • 480.965.5697 | Email

IKBKG (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  IKBKG
Gene Name:  inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH010484.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00001554

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1260nts         Open reading frame : 1 to 1260
Reference Sequence Alignment

ATGAATAGGCACCTCTGGAAGAGCCAACTGTGTGAGATGGTGCAGCCCAGTGGTGGCCCG
GCAGCAGATCAGGACGTACTGGGCGAAGAGTCTCCTCTGGGGAAGCCAGCCATGCTGCAC
CTGCCTTCAGAACAGGGCGCTCCTGAGACCCTCCAGCGCTGCCTGGAGGAGAATCAAGAG
CTCCGAGATGCCATCCGGCAGAGCAACCAGATTCTGCGGGAGCGCTGCGAGGAGCTTCTG
CATTTCCAAGCCAGCCAGAGGGAGGAGAAGGAGTTCCTCATGTGCAAGTTCCAGGAGGCC
AGGAAACTGGTGGAGAGACTCGGCCTGGAGAAGCTCGATCTGAAGAGGCAGAAGGAGCAG
GCTCTGCGGGAGGTGGAGCACCTGAAGAGATGCCAGCAGCAGATGGCTGAGGACAAGGCC
TCTGTGAAAGCCCAGGTGACGTCCTTGCTCGGGGAGCTGCAGGAGAGCCAGAGTCGCTTG
GAGGCTGCCACTAAGGAATGCCAGGCTCTGGAGGGTCGGGCCCGGGCGGCCAGCGAGCAG
GCGCGGCAGCTGGAGAGTGAGCGCGAGGCGCTGCAGCAGCAGCACAGCGTGCAGGTGGAC
CAGCTGCGCATGCAGGGCCAGAGCGTGGAGGCCGCGCTCCGCATGGAGCGCCAGGCCGCC
TCGGAGGAGAAGAGGAAGCTGGCCCAGTTGCAGGTGGCCTATCACCAGCTCTTCCAAGAA
TACGACAACCACATCAAGAGCAGCGTGGTGGGCAGTGAGCGGAAGCGAGGAATGCAGCTG
GAAGATCTCAAACAGCAGCTCCAGCAGGCCGAGGAGGCCCTGGTGGCCAAACAGGAGGTG
ATCGATAAGCTGAAGGAGGAGGCCGAGCAGCACAAGATTGTGATGGAGACCGTTCCGGTG
CTGAAGGCCCAGGCGGATATCTACAAGGCGGACTTCCAGGCTGAGAGGCAGGCCCGGGAG
AAGCTGGCCGAGAAGAAGGAGCTCCTGCAGGAGCAGCTGGAGCAGCTGCAGAGGGAGTAC
AGCAAACTGAAGGCCAGCTGTCAGGAGTCGGCCAGGATCGAGGACATGAGGAAGCGGCAT
GTCGAGGTCTCCCAGGCCCCCTTGCCCCCCGCCCCTGCCTACCTCTCCTCTCCCCTGGCC
CTGCCCAGCCAGAGGAGGAGCCCCCCCGAGGAGCCACCTGACTTCTGCTGTCCCAAGTGC
CAGTATCAGGCCCCTGATATGGACACCCTGCAGATACATGTCATGGAGTGCATTGAGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1408
Start on reference sequence 149
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : IKBKG
Symbol Nomenclature : IKBKG
SYNONYM : AMCBX1; FIP-3; FIP3; Fip3p; IKK-gamma; IP; IP1; IP2; IPD2; NEMO; ZC2HC9
Designation : I-kappa-B kinase subunit gamma|IKKAP1|IKKG|IkB kinase gamma subunit|NF-kappa-B essential modifier|NF-kappa-B essential modulator|NFkappaB essential modulator|ikB kinase subunit gamma|ikB kinase-associated protein 1|incontinentia pigmenti|inhibitor of nuclear factor kappa-B kinase subunit gamma
Full Nomenclature : inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
GENEID : 8517
GI : 61358783
GenBank Accession : AY888678
HGNC : 5961
MIM : 300248
Vega : OTTHUMG00000024234
Target GenBank: NM_003639

 

Reference Sequence Alignment

  

HsCD00001554        ------------------------------------------------------------
NM_001099857.2      ------------------------------------------------------------
NM_003639.4         ------------------------------------------------------------
NM_001099856.3      ATGGCCCTTGTGATCCAGGTGGGGAAACTAAGGCCCAGAGAAGTGAGGACCCCGCAGACT
                                                                                

HsCD00001554        ------------------------------------------------------------
NM_001099857.2      ------------------------------------------------------------
NM_003639.4         ------------------------------------------------------------
NM_001099856.3      ATCAATCCCAGTCTCTTCCCCTCACTCCCTGTGAAGCTCTCCAGCATCATCGAGGTCCCA
                                                                                

HsCD00001554        ------------------------------------------------------------
NM_001099857.2      ------------------------------------------------------------
NM_003639.4         ------------------------------------------------------------
NM_001099856.3      TCAGGTGGGGAAAGATGCTGTTCCAGGCGCACACTAGTCTACAAGGCCAGAGCTTTCTGG
                                                                                

HsCD00001554        ------------------------ATGAATAGGCACCTCTGGAAGAGCCAACTGTGTGAG
NM_001099857.2      ------------------------ATGAATAGGCACCTCTGGAAGAGCCAACTGTGTGAG
NM_003639.4         ------------------------ATGAATAGGCACCTCTGGAAGAGCCAACTGTGTGAG
NM_001099856.3      AAGGGGGCACCCTTGCCCTGTTGGATGAATAGGCACCTCTGGAAGAGCCAACTGTGTGAG
                                            ************************************

HsCD00001554        ATGGTGCAGCCCAGTGGTGGCCCGGCAGCAGATCAGGACGTACTGGGCGAAGAGTCTCCT
NM_001099857.2      ATGGTGCAGCCCAGTGGTGGCCCGGCAGCAGATCAGGACGTACTGGGCGAAGAGTCTCCT
NM_003639.4         ATGGTGCAGCCCAGTGGTGGCCCGGCAGCAGATCAGGACGTACTGGGCGAAGAGTCTCCT
NM_001099856.3      ATGGTGCAGCCCAGTGGTGGCCCGGCAGCAGATCAGGACGTACTGGGCGAAGAGTCTCCT
                    ************************************************************

HsCD00001554        CTGGGGAAGCCAGCCATGCTGCACCTGCCTTCAGAACAGGGCGCTCCTGAGACCCTCCAG
NM_001099857.2      CTGGGGAAGCCAGCCATGCTGCACCTGCCTTCAGAACAGGGCGCTCCTGAGACCCTCCAG
NM_003639.4         CTGGGGAAGCCAGCCATGCTGCACCTGCCTTCAGAACAGGGCGCTCCTGAGACCCTCCAG
NM_001099856.3      CTGGGGAAGCCAGCCATGCTGCACCTGCCTTCAGAACAGGGCGCTCCTGAGACCCTCCAG
                    ************************************************************

HsCD00001554        CGCTGCCTGGAGGAGAATCAAGAGCTCCGAGATGCCATCCGGCAGAGCAACCAGATTCTG
NM_001099857.2      CGCTGCCTGGAGGAGAATCAAGAGCTCCGAGATGCCATCCGGCAGAGCAACCAGATTCTG
NM_003639.4         CGCTGCCTGGAGGAGAATCAAGAGCTCCGAGATGCCATCCGGCAGAGCAACCAGATTCTG
NM_001099856.3      CGCTGCCTGGAGGAGAATCAAGAGCTCCGAGATGCCATCCGGCAGAGCAACCAGATTCTG
                    ************************************************************

HsCD00001554        CGGGAGCGCTGCGAGGAGCTTCTGCATTTCCAAGCCAGCCAGAGGGAGGAGAAGGAGTTC
NM_001099857.2      CGGGAGCGCTGCGAGGAGCTTCTGCATTTCCAAGCCAGCCAGAGGGAGGAGAAGGAGTTC
NM_003639.4         CGGGAGCGCTGCGAGGAGCTTCTGCATTTCCAAGCCAGCCAGAGGGAGGAGAAGGAGTTC
NM_001099856.3      CGGGAGCGCTGCGAGGAGCTTCTGCATTTCCAAGCCAGCCAGAGGGAGGAGAAGGAGTTC
                    ************************************************************

HsCD00001554        CTCATGTGCAAGTTCCAGGAGGCCAGGAAACTGGTGGAGAGACTCGGCCTGGAGAAGCTC
NM_001099857.2      CTCATGTGCAAGTTCCAGGAGGCCAGGAAACTGGTGGAGAGACTCGGCCTGGAGAAGCTC
NM_003639.4         CTCATGTGCAAGTTCCAGGAGGCCAGGAAACTGGTGGAGAGACTCGGCCTGGAGAAGCTC
NM_001099856.3      CTCATGTGCAAGTTCCAGGAGGCCAGGAAACTGGTGGAGAGACTCGGCCTGGAGAAGCTC
                    ************************************************************

HsCD00001554        GATCTGAAGAGGCAGAAGGAGCAGGCTCTGCGGGAGGTGGAGCACCTGAAGAGATGCCAG
NM_001099857.2      GATCTGAAGAGGCAGAAGGAGCAGGCTCTGCGGGAGGTGGAGCACCTGAAGAGATGCCAG
NM_003639.4         GATCTGAAGAGGCAGAAGGAGCAGGCTCTGCGGGAGGTGGAGCACCTGAAGAGATGCCAG
NM_001099856.3      GATCTGAAGAGGCAGAAGGAGCAGGCTCTGCGGGAGGTGGAGCACCTGAAGAGATGCCAG
                    ************************************************************

HsCD00001554        CAGCAGATGGCTGAGGACAAGGCCTCTGTGAAAGCCCAGGTGACGTCCTTGCTCGGGGAG
NM_001099857.2      CAGCAGATGGCTGAGGACAAGGCCTCTGTGAAAGCCCAGGTGACGTCCTTGCTCGGGGAG
NM_003639.4         CAGCAGATGGCTGAGGACAAGGCCTCTGTGAAAGCCCAGGTGACGTCCTTGCTCGGGGAG
NM_001099856.3      CAGCAGATGGCTGAGGACAAGGCCTCTGTGAAAGCCCAGGTGACGTCCTTGCTCGGGGAG
                    ************************************************************

HsCD00001554        CTGCAGGAGAGCCAGAGTCGCTTGGAGGCTGCCACTAAGGAATGCCAGGCTCTGGAGGGT
NM_001099857.2      CTGCAGGAGAGCCAGAGTCGCTTGGAGGCTGCCACTAAGGAATGCCAGGCTCTGGAGGGT
NM_003639.4         CTGCAGGAGAGCCAGAGTCGCTTGGAGGCTGCCACTAAGGAATGCCAGGCTCTGGAGGGT
NM_001099856.3      CTGCAGGAGAGCCAGAGTCGCTTGGAGGCTGCCACTAAGGAATGCCAGGCTCTGGAGGGT
                    ************************************************************

HsCD00001554        CGGGCCCGGGCGGCCAGCGAGCAGGCGCGGCAGCTGGAGAGTGAGCGCGAGGCGCTGCAG
NM_001099857.2      CGGGCCCGGGCGGCCAGCGAGCAGGCGCGGCAGCTGGAGAGTGAGCGCGAGGCGCTGCAG
NM_003639.4         CGGGCCCGGGCGGCCAGCGAGCAGGCGCGGCAGCTGGAGAGTGAGCGCGAGGCGCTGCAG
NM_001099856.3      CGGGCCCGGGCGGCCAGCGAGCAGGCGCGGCAGCTGGAGAGTGAGCGCGAGGCGCTGCAG
                    ************************************************************

HsCD00001554        CAGCAGCACAGCGTGCAGGTGGACCAGCTGCGCATGCAGGGCCAGAGCGTGGAGGCCGCG
NM_001099857.2      CAGCAGCACAGCGTGCAGGTGGACCAGCTGCGCATGCAGGGCCAGAGCGTGGAGGCCGCG
NM_003639.4         CAGCAGCACAGCGTGCAGGTGGACCAGCTGCGCATGCAGGGCCAGAGCGTGGAGGCCGCG
NM_001099856.3      CAGCAGCACAGCGTGCAGGTGGACCAGCTGCGCATGCAGGGCCAGAGCGTGGAGGCCGCG
                    ************************************************************

HsCD00001554        CTCCGCATGGAGCGCCAGGCCGCCTCGGAGGAGAAGAGGAAGCTGGCCCAGTTGCAGGTG
NM_001099857.2      CTCCGCATGGAGCGCCAGGCCGCCTCGGAGGAGAAGAGGAAGCTGGCCCAGTTGCAGGTG
NM_003639.4         CTCCGCATGGAGCGCCAGGCCGCCTCGGAGGAGAAGAGGAAGCTGGCCCAGTTGCAGGTG
NM_001099856.3      CTCCGCATGGAGCGCCAGGCCGCCTCGGAGGAGAAGAGGAAGCTGGCCCAGTTGCAGGTG
                    ************************************************************

HsCD00001554        GCCTATCACCAGCTCTTCCAAGAATACGACAACCACATCAAGAGCAGCGTGGTGGGCAGT
NM_001099857.2      GCCTATCACCAGCTCTTCCAAGAATACGACAACCACATCAAGAGCAGCGTGGTGGGCAGT
NM_003639.4         GCCTATCACCAGCTCTTCCAAGAATACGACAACCACATCAAGAGCAGCGTGGTGGGCAGT
NM_001099856.3      GCCTATCACCAGCTCTTCCAAGAATACGACAACCACATCAAGAGCAGCGTGGTGGGCAGT
                    ************************************************************

HsCD00001554        GAGCGGAAGCGAGGAATGCAGCTGGAAGATCTCAAACAGCAGCTCCAGCAGGCCGAGGAG
NM_001099857.2      GAGCGGAAGCGAGGAATGCAGCTGGAAGATCTCAAACAGCAGCTCCAGCAGGCCGAGGAG
NM_003639.4         GAGCGGAAGCGAGGAATGCAGCTGGAAGATCTCAAACAGCAGCTCCAGCAGGCCGAGGAG
NM_001099856.3      GAGCGGAAGCGAGGAATGCAGCTGGAAGATCTCAAACAGCAGCTCCAGCAGGCCGAGGAG
                    ************************************************************

HsCD00001554        GCCCTGGTGGCCAAACAGGAGGTGATCGATAAGCTGAAGGAGGAGGCCGAGCAGCACAAG
NM_001099857.2      GCCCTGGTGGCCAAACAGGAGGTGATCGATAAGCTGAAGGAGGAGGCCGAGCAGCACAAG
NM_003639.4         GCCCTGGTGGCCAAACAGGAGGTGATCGATAAGCTGAAGGAGGAGGCCGAGCAGCACAAG
NM_001099856.3      GCCCTGGTGGCCAAACAGGAGGTGATCGATAAGCTGAAGGAGGAGGCCGAGCAGCACAAG
                    ************************************************************

HsCD00001554        ATTGTGATGGAGACCGTTCCGGTGCTGAAGGCCCAGGCGGATATCTACAAGGCGGACTTC
NM_001099857.2      ATTGTGATGGAGACCGTTCCGGTGCTGAAGGCCCAGGCGGATATCTACAAGGCGGACTTC
NM_003639.4         ATTGTGATGGAGACCGTTCCGGTGCTGAAGGCCCAGGCGGATATCTACAAGGCGGACTTC
NM_001099856.3      ATTGTGATGGAGACCGTTCCGGTGCTGAAGGCCCAGGCGGATATCTACAAGGCGGACTTC
                    ************************************************************

HsCD00001554        CAGGCTGAGAGGCAGGCCCGGGAGAAGCTGGCCGAGAAGAAGGAGCTCCTGCAGGAGCAG
NM_001099857.2      CAGGCTGAGAGGCAGGCCCGGGAGAAGCTGGCCGAGAAGAAGGAGCTCCTGCAGGAGCAG
NM_003639.4         CAGGCTGAGAGGCAGGCCCGGGAGAAGCTGGCCGAGAAGAAGGAGCTCCTGCAGGAGCAG
NM_001099856.3      CAGGCTGAGAGGCAGGCCCGGGAGAAGCTGGCCGAGAAGAAGGAGCTCCTGCAGGAGCAG
                    ************************************************************

HsCD00001554        CTGGAGCAGCTGCAGAGGGAGTACAGCAAACTGAAGGCCAGCTGTCAGGAGTCGGCCAGG
NM_001099857.2      CTGGAGCAGCTGCAGAGGGAGTACAGCAAACTGAAGGCCAGCTGTCAGGAGTCGGCCAGG
NM_003639.4         CTGGAGCAGCTGCAGAGGGAGTACAGCAAACTGAAGGCCAGCTGTCAGGAGTCGGCCAGG
NM_001099856.3      CTGGAGCAGCTGCAGAGGGAGTACAGCAAACTGAAGGCCAGCTGTCAGGAGTCGGCCAGG
                    ************************************************************

HsCD00001554        ATCGAGGACATGAGGAAGCGGCATGTCGAGGTCTCCCAGGCCCCCTTGCCCCCCGCCCCT
NM_001099857.2      ATCGAGGACATGAGGAAGCGGCATGTCGAGGTCTCCCAGGCCCCCTTGCCCCCCGCCCCT
NM_003639.4         ATCGAGGACATGAGGAAGCGGCATGTCGAGGTCTCCCAGGCCCCCTTGCCCCCCGCCCCT
NM_001099856.3      ATCGAGGACATGAGGAAGCGGCATGTCGAGGTCTCCCAGGCCCCCTTGCCCCCCGCCCCT
                    ************************************************************

HsCD00001554        GCCTACCTCTCCTCTCCCCTGGCCCTGCCCAGCCAGAGGAGGAGCCCCCCCGAGGAGCCA
NM_001099857.2      GCCTACCTCTCCTCTCCCCTGGCCCTGCCCAGCCAGAGGAGGAGCCCCCCCGAGGAGCCA
NM_003639.4         GCCTACCTCTCCTCTCCCCTGGCCCTGCCCAGCCAGAGGAGGAGCCCCCCCGAGGAGCCA
NM_001099856.3      GCCTACCTCTCCTCTCCCCTGGCCCTGCCCAGCCAGAGGAGGAGCCCCCCCGAGGAGCCA
                    ************************************************************

HsCD00001554        CCTGACTTCTGCTGTCCCAAGTGCCAGTATCAGGCCCCTGATATGGACACCCTGCAGATA
NM_001099857.2      CCTGACTTCTGCTGTCCCAAGTGCCAGTATCAGGCCCCTGATATGGACACCCTGCAGATA
NM_003639.4         CCTGACTTCTGCTGTCCCAAGTGCCAGTATCAGGCCCCTGATATGGACACCCTGCAGATA
NM_001099856.3      CCTGACTTCTGCTGTCCCAAGTGCCAGTATCAGGCCCCTGATATGGACACCCTGCAGATA
                    ************************************************************

HsCD00001554        CATGTCATGGAGTGCATTGAGTAG
NM_001099857.2      CATGTCATGGAGTGCATTGAGTAG
NM_003639.4         CATGTCATGGAGTGCATTGAGTAG
NM_001099856.3      CATGTCATGGAGTGCATTGAGTAG
                    ************************

Pathways

NCI : BCR signaling pathway
NCI : Canonical NF-kappaB pathway
NCI : Endogenous TLR signaling
NCI : FAS (CD95) signaling pathway
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : IL1-mediated signaling events
NCI : TCR signaling in naïve CD4+ T cells
NCI : TCR signaling in naïve CD8+ T cells
NCI : TNF receptor signaling pathway
NCI : TRAIL signaling pathway
NCI : p75(NTR)-mediated signaling
Reactome : Activated TLR4 signalling
Reactome : Activation of NF-kappaB in B cells
Reactome : Adaptive Immune System
Reactome : Cytokine Signaling in Immune system
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : Downstream TCR signaling
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : FCERI mediated NF-kB activation
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : IKK complex recruitment mediated by RIP1
Reactome : IRAK1 recruits IKK complex
Reactome : IRAK1 recruits IKK complex upon TLR7/8 or 9 stimulation
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-1 signaling
Reactome : JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1
Reactome : MAP kinase activation in TLR cascade
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NF-kB activation through FADD/RIP-1 pathway mediated by caspase-8 and -10
Reactome : NOD1/2 Signaling Pathway
Reactome : Nucleotide-binding domain, leucine rich repeat containing receptor (NLR) signaling pathways
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : RIP-mediated NFkB activation via ZBP1
Reactome : Signaling by Interleukins
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : TAK1 activates NFkB by phosphorylation and activation of IKKs complex
Reactome : TCR signaling
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated NF-kB activation
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : ZBP1(DAI) mediated induction of type I IFNs
Reactome : activated TAK1 mediates p38 MAPK activation
WikiPathway : Apoptosis
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : EBV LMP1 signaling
WikiPathway : IL-1 signaling pathway
WikiPathway : Leptin signaling pathway
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : NLR proteins
WikiPathway : NOD pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : TCR Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway

Protein

UniProt : Q9Y6K9
HPRD : 02217

Clone

Cloning Information : 10484
HIP Master Clone ID : 14621
Original Clone ID : FLH010484.01X

Organism


TAX_ID : 9606
Species Specific ID: 8517

Genome

Chromosome : X
Map Location : Xq28
Ensembl : ENSG00000073009

Reagents

Labome : IKKgamma-antibody