DNASU Plasmid Repository • 480.965.5697 | Email

YWHAQ (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  YWHAQ
Gene Name:  tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH010399.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00001569

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 738nts         Open reading frame : 1 to 738
Reference Sequence Alignment

ATGGAGAAGACTGAGCTGATCCAGAAGGCCAAGCTGGCCGAGCAGGCCGAGCGCTACGAC
GACATGGCCACCTGCATGAAGGCAGTGACCGAGCAGGGCGCCGAGCTGTCCAACGAGGAG
CGCAACCTGCTCTCCGTGGCCTACAAGAACGTGGTCGGGGGCCGCAGGTCCGCCTGGAGG
GTCATCTCTAGCATCGAGCAGAAGACCGACACCTCCGACAAGAAGTTGCAGCTGATTAAG
GACTATCGGGAGAAAGTGGAGTCCGAGCTGAGATCCATCTGCACCACGGTGCTGGAATTG
TTGGATAAATATTTAATAGCCAATGCAACTAATCCAGAGAGTAAGGTCTTCTATCTGAAA
ATGAAGGGTGATTACTTCCGGTACCTTGCTGAAGTTGCGTGTGGTGATGATCGAAAACAA
ACGATAGATAATTCCCAAGGAGCTTACCAAGAGGCATTTGATATAAGCAAGAAAGAGATG
CAACCCACACACCCAATCCGCCTGGGGCTTGCTCTTAACTTTTCTGTATTTTACTATGAG
ATTCTTAATAACCCAGAGCTTGCCTGCACGCTGGCTAAAACGGCTTTTGATGAGGCCATT
GCTGAACTTGATACACTGAATGAAGACTCATACAAAGACAGCACCCTCATCATGCAGTTG
CTTAGAGACAACCTAACACTTTGGACATCAGACAGTGCAGGAGAAGAATGTGATGCGGCA
GAAGGGGCTGAAAACTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 838
Start on reference sequence 101
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : YWHAQ
Symbol Nomenclature : YWHAQ
SYNONYM : 14-3-3; 1C5; HS1
Designation : 14-3-3 protein T-cell|14-3-3 protein tau|14-3-3 protein theta|tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide
Full Nomenclature : tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta
GENEID : 10971
GI : 61368885
GenBank Accession : AY891326
HGNC : 12854
MIM : 609009
Vega : OTTHUMG00000013848
Target GenBank: NM_006826

 

Reference Sequence Alignment

  

HsCD00001569      ATGGAGAAGACTGAGCTGATCCAGAAGGCCAAGCTGGCCGAGCAGGCCGAGCGCTACGAC
NM_006826.3       ATGGAGAAGACTGAGCTGATCCAGAAGGCCAAGCTGGCCGAGCAGGCCGAGCGCTACGAC
                  ************************************************************

HsCD00001569      GACATGGCCACCTGCATGAAGGCAGTGACCGAGCAGGGCGCCGAGCTGTCCAACGAGGAG
NM_006826.3       GACATGGCCACCTGCATGAAGGCAGTGACCGAGCAGGGCGCCGAGCTGTCCAACGAGGAG
                  ************************************************************

HsCD00001569      CGCAACCTGCTCTCCGTGGCCTACAAGAACGTGGTCGGGGGCCGCAGGTCCGCCTGGAGG
NM_006826.3       CGCAACCTGCTCTCCGTGGCCTACAAGAACGTGGTCGGGGGCCGCAGGTCCGCCTGGAGG
                  ************************************************************

HsCD00001569      GTCATCTCTAGCATCGAGCAGAAGACCGACACCTCCGACAAGAAGTTGCAGCTGATTAAG
NM_006826.3       GTCATCTCTAGCATCGAGCAGAAGACCGACACCTCCGACAAGAAGTTGCAGCTGATTAAG
                  ************************************************************

HsCD00001569      GACTATCGGGAGAAAGTGGAGTCCGAGCTGAGATCCATCTGCACCACGGTGCTGGAATTG
NM_006826.3       GACTATCGGGAGAAAGTGGAGTCCGAGCTGAGATCCATCTGCACCACGGTGCTGGAATTG
                  ************************************************************

HsCD00001569      TTGGATAAATATTTAATAGCCAATGCAACTAATCCAGAGAGTAAGGTCTTCTATCTGAAA
NM_006826.3       TTGGATAAATATTTAATAGCCAATGCAACTAATCCAGAGAGTAAGGTCTTCTATCTGAAA
                  ************************************************************

HsCD00001569      ATGAAGGGTGATTACTTCCGGTACCTTGCTGAAGTTGCGTGTGGTGATGATCGAAAACAA
NM_006826.3       ATGAAGGGTGATTACTTCCGGTACCTTGCTGAAGTTGCGTGTGGTGATGATCGAAAACAA
                  ************************************************************

HsCD00001569      ACGATAGATAATTCCCAAGGAGCTTACCAAGAGGCATTTGATATAAGCAAGAAAGAGATG
NM_006826.3       ACGATAGATAATTCCCAAGGAGCTTACCAAGAGGCATTTGATATAAGCAAGAAAGAGATG
                  ************************************************************

HsCD00001569      CAACCCACACACCCAATCCGCCTGGGGCTTGCTCTTAACTTTTCTGTATTTTACTATGAG
NM_006826.3       CAACCCACACACCCAATCCGCCTGGGGCTTGCTCTTAACTTTTCTGTATTTTACTATGAG
                  ************************************************************

HsCD00001569      ATTCTTAATAACCCAGAGCTTGCCTGCACGCTGGCTAAAACGGCTTTTGATGAGGCCATT
NM_006826.3       ATTCTTAATAACCCAGAGCTTGCCTGCACGCTGGCTAAAACGGCTTTTGATGAGGCCATT
                  ************************************************************

HsCD00001569      GCTGAACTTGATACACTGAATGAAGACTCATACAAAGACAGCACCCTCATCATGCAGTTG
NM_006826.3       GCTGAACTTGATACACTGAATGAAGACTCATACAAAGACAGCACCCTCATCATGCAGTTG
                  ************************************************************

HsCD00001569      CTTAGAGACAACCTAACACTTTGGACATCAGACAGTGCAGGAGAAGAATGTGATGCGGCA
NM_006826.3       CTTAGAGACAACCTAACACTTTGGACATCAGACAGTGCAGGAGAAGAATGTGATGCGGCA
                  ************************************************************

HsCD00001569      GAAGGGGCTGAAAACTTG
NM_006826.3       GAAGGGGCTGAAAACTAA
                  ****************:.

Pathways

NCI : Class I PI3K signaling events mediated by Akt
NCI : ErbB1 downstream signaling
NCI : FoxO family signaling
NCI : Insulin-mediated glucose transport
NCI : LKB1 signaling events
NCI : PDGFR-beta signaling pathway
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : Validated transcriptional targets of TAp63 isoforms
NCI : a6b1 and a6b4 Integrin signaling
NCI : mTOR signaling pathway
NCI : p38 signaling mediated by MAPKAP kinases
Panther : EGF receptor signaling pathway
Panther : FGF signaling pathway
Panther : Parkinson disease
Reactome : Activation of BAD and translocation to mitochondria
Reactome : Activation of BH3-only proteins
Reactome : Apoptosis
Reactome : Intrinsic Pathway for Apoptosis
Reactome : Membrane Trafficking
Reactome : Translocation of GLUT4 to the plasma membrane
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : Cell cycle
WikiPathway : Epithelium TarBase
WikiPathway : IL-3 Signaling Pathway
WikiPathway : Leukocyte TarBase
WikiPathway : Lymphocyte TarBase
WikiPathway : Muscle cell TarBase
WikiPathway : Myometrial Relaxation and Contraction Pathways
WikiPathway : Squamous cell TarBase

Protein

SMART domain : 14_3_3 : 14-3-3 homologues
UniProt : P27348
HPRD : 00886

Clone

Cloning Information : 10399
HIP Master Clone ID : 14536
Original Clone ID : FLH010399.01L

Organism


TAX_ID : 9606
Species Specific ID: 10971

Genome

Chromosome : 2
Map Location : 2p25.1
Ensembl : ENSG00000134308