DNASU Plasmid Repository • 480.965.5697 | Email

GPRK5 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  GRK5
Gene Name:  G protein-coupled receptor kinase 5
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH000161.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00001581

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1773nts         Open reading frame : 1 to 1773
Reference Sequence Alignment

ATGGAGCTGGAAAACATCGTGGCCAACACGGTCTTGCTGAAAGCCAGGGAAGGGGGCGGA
GGAAAGCGCAAAGGGAAAAGCAAGAAGTGGAAAGAAATCCTGAAGTTCCCTCACATTAGC
CAGTGTGAAGACCTCCGAAGGACCATAGACAGAGATTACTGCAGTTTATGTGACAAGCAG
CCAATCGGGAGGCTGCTTTTCCGGCAGTTTTGTGAAACCAGGCCTGGGCTGGAGTGTTAC
ATTCAGTTCCTGGACTCCGTGGCAGAATATGAAGTTACTCCAGATGAAAAACTGGGAGAG
AAAGGGAAGGAAATTATGACCAAGTACCTCACCCCAAAGTCCCCTGTTTTCATAGCCCAA
GTTGGCCAAGACCTGGTCTCCCAGACGGAGGAGAAGCTCCTACAGAAGCCGTGCAAAGAA
CTCTTTTCTGCCTGTGCACAGTCTGTCCACGAGTACCTGAGGGGAGAACCATTCCACGAA
TATCTGGACAGCATGTTTTTTGACCGCTTTCTCCAGTGGAAGTGGTTGGAAAGGCAACCG
GTGACCAAAAACACTTTCAGGCAGTATCGAGTGCTAGGAAAAGGGGGCTTCGGGGAGGTC
TGTGCCTGCCAGGTTCGGGCCACGGGTAAAATGTATGCCTGCAAGCGCTTGGAGAAGAAG
AGGATCAAAAAGAGGAAAGGGGAGTCCATGGCCCTCAATGAGAAGCAGATCCTCGAGAAG
GTCAACAGTCAGTTTGTGGTCAACCTGGCCTATGCCTACGAGACCAAGGATGCACTGTGC
TTGGTCCTGACCATCATGAATGGGGGTGACCTGAAGTTCCACATCTACAACATGGGCAAC
CCTGGCTTCGAGGAGGAGCGGGCCTTGTTTTATGCGGCAGAGATCCTCTGCGGCTTAGAA
GACCTCCACCGTGAGAACACCGTCTACCGAGATCTGAAACCTGAAAACATCCTGTTAGAT
GATTATGGCCACATTAGGATCTCAGACCTGGGCTTGGCTGTGAAGATCCCCGAGGGAGAC
CTGATCCGCGGCCGGGTGGGCACTGTTGGCTACATGGCTCCAGAGGTCCTGAACAACCAG
AGGTACGGCCTGAGCCCCGACTACTGGGGCCTTGGCTGCCTCATCTATGAGATGATCGAG
GGCCAGTCGCCGTTCCGCGGCCGCAAGGAGAAGGTGAAGCGGGAGGAGGTGGACCGCCGG
GTCCTGGAGACGGAGGAGGTGTACTCCCACAAGTTCTCCGAGGAGGCCAAGTCCATCTGC
AAGATGCTGCTCACGAAAGATGCGAAGCAGAGGCTGGGCTGCCAGGAGGAGGGGGCTGCA
GAGGTCAAGAGACACCCCTTCTTCAGGAACATGAACTTCAAGCGCTTAGAAGCCGGGATG
TTGGACCCTCCCTTCGTTCCAGACCCCCGCGCTGTGTACTGTAAGGACGTGCTGGACATC
GAGCAGTTCTCCACTGTGAAGGGCGTCAATCTGGACCACACAGACGACGACTTCTACTCC
AAGTTCTCCACGGGCTCTGTGTCCATCCCATGGCAAAACGAGATGATAGAAACAGAATGC
TTTAAGGAGCTGAACGTGTTTGGACCTAATGGTACCCTCCCGCCAGATCTGAACAGAAAC
CACCCTCCGGAACCGCCCAAGAAAGGGCTGCTCCAGAGACTCTTCAAGCGGCAGCATCAG
AACAATTCCAAGAGTTCGCCCAGCTCCAAGACCAGTTTTAACCACCACATAAACTCAAAC
CATGTCAGCTCGAACTCCACCGGAAGCAGCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1993
Start on reference sequence 221
Mutations:
None
Discrepancy:
c1059t; c1062a; a1065g; t1164c
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : GRK5
Symbol Nomenclature : GRK5
SYNONYM : GPRK5
Designation : FP2025|g protein-coupled receptor kinase GRK5
Full Nomenclature : G protein-coupled receptor kinase 5
GENEID : 2869
Locus Tag : RP11-714M16.1
GI : 33304024
GenBank Accession : AY335693
HGNC : 4544
MIM : 600870
Vega : OTTHUMG00000019149
Target GenBank: NM_005308

 

Reference Sequence Alignment

  

HsCD00001581        ATGGAGCTGGAAAACATCGTGGCCAACACGGTCTTGCTGAAAGCCAGGGAAGGGGGCGGA
NM_005308.2         ATGGAGCTGGAAAACATCGTGGCCAACACGGTCTTGCTGAAAGCCAGGGAAGGGGGCGGA
XM_005269707.1      ATGGAGCTGGAAAACATCGTGGCCAACACGGTCTTGCTGAAAGCCAGGGAAGGGGGCGGA
XM_005269708.1      ATGGAGCTGGAAAACATCGTGGCCAACACGGTCTTGCTGAAAGCCAGG------------
                    ************************************************            

HsCD00001581        GGAAAGCGCAAAGGGAAAAGCAAGAAGTGGAAAGAAATCCTGAAGTTCCCTCACATTAGC
NM_005308.2         GGAAAGCGCAAAGGGAAAAGCAAGAAGTGGAAAGAAATCCTGAAGTTCCCTCACATTAGC
XM_005269707.1      GGAAAGCGCAAAGGGAAAAGCAAGAAGTGGAAAGAAATCCTGAAGTTCCCTCACATTAGC
XM_005269708.1      ------------------------------------------------------------
                                                                                

HsCD00001581        CAGTGTGAAGACCTCCGAAGGACCATAGACAGAGATTACTGCAGTTTATGTGACAAGCAG
NM_005308.2         CAGTGTGAAGACCTCCGAAGGACCATAGACAGAGATTACTGCAGTTTATGTGACAAGCAG
XM_005269707.1      CAGTGTGAAGACCTCCGAAGGACCATAGACAGAGATTACTGCAGTTTATGTGACAAGCAG
XM_005269708.1      ------------------------GAAGACAGAGATTACTGCAGTTTATGTGACAAGCAG
                                            .:**********************************

HsCD00001581        CCAATCGGGAGGCTGCTTTTCCGGCAGTTTTGTGAAACCAGGCCTGGGCTGGAGTGTTAC
NM_005308.2         CCAATCGGGAGGCTGCTTTTCCGGCAGTTTTGTGAAACCAGGCCTGGGCTGGAGTGTTAC
XM_005269707.1      CCAATCGGGAGGCTGCTTTTCCGGCAGTTTTGTGAAACCAGGCCTGGGCTGGAGTGTTAC
XM_005269708.1      CCAATCGGGAGGCTGCTTTTCCGGCAGTTTTGTGAAACCAGGCCTGGGCTGGAGTGTTAC
                    ************************************************************

HsCD00001581        ATTCAGTTCCTGGACTCCGTGGCAGAATATGAAGTTACTCCAGATGAAAAACTGGGAGAG
NM_005308.2         ATTCAGTTCCTGGACTCCGTGGCAGAATATGAAGTTACTCCAGATGAAAAACTGGGAGAG
XM_005269707.1      ATTCAGTTCCTGGACTCCGTGGCAGAATATGAAGTTACTCCAGATGAAAAACTGGGAGAG
XM_005269708.1      ATTCAGTTCCTGGACTCCGTGGCAGAATATGAAGTTACTCCAGATGAAAAACTGGGAGAG
                    ************************************************************

HsCD00001581        AAAGGGAAGGAAATTATGACCAAGTACCTCACCCCAAAGTCCCCTGTTTTCATAGCCCAA
NM_005308.2         AAAGGGAAGGAAATTATGACCAAGTACCTCACCCCAAAGTCCCCTGTTTTCATAGCCCAA
XM_005269707.1      AAAGGGAAGGAAATTATGACCAAGTACCTCACCCCAAAGTCCCCTGTTTTCATAGCCCAA
XM_005269708.1      AAAGGGAAGGAAATTATGACCAAGTACCTCACCCCAAAGTCCCCTGTTTTCATAGCCCAA
                    ************************************************************

HsCD00001581        GTTGGCCAAGACCTGGTCTCCCAGACGGAGGAGAAGCTCCTACAGAAGCCGTGCAAAGAA
NM_005308.2         GTTGGCCAAGACCTGGTCTCCCAGACGGAGGAGAAGCTCCTACAGAAGCCGTGCAAAGAA
XM_005269707.1      GTTGGCCAAGACCTGGTCTCCCAGACGGAGGAGAAGCTCCTACAGAAGCCGTGCAAAGAA
XM_005269708.1      GTTGGCCAAGACCTGGTCTCCCAGACGGAGGAGAAGCTCCTACAGAAGCCGTGCAAAGAA
                    ************************************************************

HsCD00001581        CTCTTTTCTGCCTGTGCACAGTCTGTCCACGAGTACCTGAGGGGAGAACCATTCCACGAA
NM_005308.2         CTCTTTTCTGCCTGTGCACAGTCTGTCCACGAGTACCTGAGGGGAGAACCATTCCACGAA
XM_005269707.1      CTCTTTTCTGCCTGTGCACAGTCTGTCCACGAGTACCTGAGGGGAGAACCATTCCACGAA
XM_005269708.1      CTCTTTTCTGCCTGTGCACAGTCTGTCCACGAGTACCTGAGGGGAGAACCATTCCACGAA
                    ************************************************************

HsCD00001581        TATCTGGACAGCATGTTTTTTGACCGCTTTCTCCAGTGGAAGTGGTTGGAAAGGCAACCG
NM_005308.2         TATCTGGACAGCATGTTTTTTGACCGCTTTCTCCAGTGGAAGTGGTTGGAAAGGCAACCG
XM_005269707.1      TATCTGGACAGCATGTTTTTTGACCGCTTTCTCCAGTGGAAGTGGTTGGAAAGGCAACCG
XM_005269708.1      TATCTGGACAGCATGTTTTTTGACCGCTTTCTCCAGTGGAAGTGGTTGGAAAGGCAACCG
                    ************************************************************

HsCD00001581        GTGACCAAAAACACTTTCAGGCAGTATCGAGTGCTAGGAAAAGGGGGCTTCGGGGAGGTC
NM_005308.2         GTGACCAAAAACACTTTCAGGCAGTATCGAGTGCTAGGAAAAGGGGGCTTCGGGGAGGTC
XM_005269707.1      GTGACCAAAAACACTTTCAGGCAGTATCGAGTGCTAGGAAAAGGGGGCTTCGGGGAGGTC
XM_005269708.1      GTGACCAAAAACACTTTCAGGCAGTATCGAGTGCTAGGAAAAGGGGGCTTCGGGGAGGTC
                    ************************************************************

HsCD00001581        TGTGCCTGCCAGGTTCGGGCCACGGGTAAAATGTATGCCTGCAAGCGCTTGGAGAAGAAG
NM_005308.2         TGTGCCTGCCAGGTTCGGGCCACGGGTAAAATGTATGCCTGCAAGCGCTTGGAGAAGAAG
XM_005269707.1      TGTGCCTGCCAGGTTCGGGCCACGGGTAAAATGTATGCCTGCAAGCGCTTGGAGAAGAAG
XM_005269708.1      TGTGCCTGCCAGGTTCGGGCCACGGGTAAAATGTATGCCTGCAAGCGCTTGGAGAAGAAG
                    ************************************************************

HsCD00001581        AGGATCAAAAAGAGGAAAGGGGAGTCCATGGCCCTCAATGAGAAGCAGATCCTCGAGAAG
NM_005308.2         AGGATCAAAAAGAGGAAAGGGGAGTCCATGGCCCTCAATGAGAAGCAGATCCTCGAGAAG
XM_005269707.1      AGGATCAAAAAGAGGAAAGGGGAGTCCATGGCCCTCAATGAGAAGCAGATCCTCGAGAAG
XM_005269708.1      AGGATCAAAAAGAGGAAAGGGGAGTCCATGGCCCTCAATGAGAAGCAGATCCTCGAGAAG
                    ************************************************************

HsCD00001581        GTCAACAGTCAGTTTGTGGTCAACCTGGCCTATGCCTACGAGACCAAGGATGCACTGTGC
NM_005308.2         GTCAACAGTCAGTTTGTGGTCAACCTGGCCTATGCCTACGAGACCAAGGATGCACTGTGC
XM_005269707.1      GTCAACAGTCAGTTTGTGGTCAACCTGGCCTATGCCTACGAGACCAAGGATGCACTGTGC
XM_005269708.1      GTCAACAGTCAGTTTGTGGTCAACCTGGCCTATGCCTACGAGACCAAGGATGCACTGTGC
                    ************************************************************

HsCD00001581        TTGGTCCTGACCATCATGAATGGGGGTGACCTGAAGTTCCACATCTACAACATGGGCAAC
NM_005308.2         TTGGTCCTGACCATCATGAATGGGGGTGACCTGAAGTTCCACATCTACAACATGGGCAAC
XM_005269707.1      TTGGTCCTGACCATCATGAATGGGGGTGACCTGAAGTTCCACATCTACAACATGGGCAAC
XM_005269708.1      TTGGTCCTGACCATCATGAATGGGGGTGACCTGAAGTTCCACATCTACAACATGGGCAAC
                    ************************************************************

HsCD00001581        CCTGGCTTCGAGGAGGAGCGGGCCTTGTTTTATGCGGCAGAGATCCTCTGCGGCTTAGAA
NM_005308.2         CCTGGCTTCGAGGAGGAGCGGGCCTTGTTTTATGCGGCAGAGATCCTCTGCGGCTTAGAA
XM_005269707.1      CCTGGCTTCGAGGAGGAGCGGGCCTTGTTTTATGCGGCAGAGATCCTCTGCGGCTTAGAA
XM_005269708.1      CCTGGCTTCGAGGAGGAGCGGGCCTTGTTTTATGCGGCAGAGATCCTCTGCGGCTTAGAA
                    ************************************************************

HsCD00001581        GACCTCCACCGTGAGAACACCGTCTACCGAGATCTGAAACCTGAAAACATCCTGTTAGAT
NM_005308.2         GACCTCCACCGTGAGAACACCGTCTACCGAGATCTGAAACCTGAAAACATCCTGTTAGAT
XM_005269707.1      GACCTCCACCGTGAGAACACCGTCTACCGAGATCTGAAACCTGAAAACATCCTGTTAGAT
XM_005269708.1      GACCTCCACCGTGAGAACACCGTCTACCGAGATCTGAAACCTGAAAACATCCTGTTAGAT
                    ************************************************************

HsCD00001581        GATTATGGCCACATTAGGATCTCAGACCTGGGCTTGGCTGTGAAGATCCCCGAGGGAGAC
NM_005308.2         GATTATGGCCACATTAGGATCTCAGACCTGGGCTTGGCTGTGAAGATCCCCGAGGGAGAC
XM_005269707.1      GATTATG-----------------------------------------------------
XM_005269708.1      GATTATGGCCACATTAGGATCTCAGACCTGGGCTTGGCTGTGAAGATCCCCGAGGGAGAC
                    *******                                                     

HsCD00001581        CTGATCCGCGGCCGGGTGGGCACTGTTGGCTACATGGCTCCAGAGGTCCTGAACAACCAG
NM_005308.2         CTGATCCGCGGCCGGGTGGGCACTGTTGGCTACATGGCTCCAGAGGTCCTGAACAACCAG
XM_005269707.1      -------------------------------------CTCCAGAGGTCCTGAACAACCAG
XM_005269708.1      CTGATCCGCGGCCGGGTGGGCACTGTTGGCTACATGGCTCCAGAGGTCCTGAACAACCAG
                                                         ***********************

HsCD00001581        AGGTACGGCCTGAGCCCCGACTACTGGGGCCTTGGCTGCCTCATCTATGAGATGATCGAG
NM_005308.2         AGGTACGGCCTGAGCCCCGACTACTGGGGCCTTGGCTGCCTCATCTATGAGATGATCGAG
XM_005269707.1      AGGTACGGCCTGAGCCCCGACTACTGGGGCCTTGGCTGCCTCATCTATGAGATGATCGAG
XM_005269708.1      AGGTACGGCCTGAGCCCCGACTACTGGGGCCTTGGCTGCCTCATCTATGAGATGATCGAG
                    ************************************************************

HsCD00001581        GGCCAGTCGCCGTTCCGCGGCCGCAAGGAGAAGGTGAAGCGGGAGGAGGTGGACCGCCGG
NM_005308.2         GGCCAGTCGCCGTTCCGCGGCCGCAAGGAGAAGGTGAAGCGGGAGGAGGTGGACCGCCGG
XM_005269707.1      GGCCAGTCGCCGTTCCGCGGCCGCAAGGAGAAGGTGAAGCGGGAGGAGGTGGACCGCCGG
XM_005269708.1      GGCCAGTCGCCGTTCCGCGGCCGCAAGGAGAAGGTGAAGCGGGAGGAGGTGGACCGCCGG
                    ************************************************************

HsCD00001581        GTCCTGGAGACGGAGGAGGTGTACTCCCACAAGTTCTCCGAGGAGGCCAAGTCCATCTGC
NM_005308.2         GTCCTGGAGACGGAGGAGGTGTACTCCCACAAGTTCTCCGAGGAGGCCAAGTCCATCTGC
XM_005269707.1      GTCCTGGAGACGGAGGAGGTGTACTCCCACAAGTTCTCCGAGGAGGCCAAGTCCATCTGC
XM_005269708.1      GTCCTGGAGACGGAGGAGGTGTACTCCCACAAGTTCTCCGAGGAGGCCAAGTCCATCTGC
                    ************************************************************

HsCD00001581        AAGATGCTGCTCACGAAAGATGCGAAGCAGAGGCTGGGCTGCCAGGAGGAGGGGGCTGCA
NM_005308.2         AAGATGCTGCTCACGAAAGATGCGAAGCAGAGGCTGGGCTGCCAGGAGGAGGGGGCTGCA
XM_005269707.1      AAGATGCTGCTCACGAAAGATGCGAAGCAGAGGCTGGGCTGCCAGGAGGAGGGGGCTGCA
XM_005269708.1      AAGATGCTGCTCACGAAAGATGCGAAGCAGAGGCTGGGCTGCCAGGAGGAGGGGGCTGCA
                    ************************************************************

HsCD00001581        GAGGTCAAGAGACACCCCTTCTTCAGGAACATGAACTTCAAGCGCTTAGAAGCCGGGATG
NM_005308.2         GAGGTCAAGAGACACCCCTTCTTCAGGAACATGAACTTCAAGCGCTTAGAAGCCGGGATG
XM_005269707.1      GAGGTCAAGAGACACCCCTTCTTCAGGAACATGAACTTCAAGCGCTTAGAAGCCGGGATG
XM_005269708.1      GAGGTCAAGAGACACCCCTTCTTCAGGAACATGAACTTCAAGCGCTTAGAAGCCGGGATG
                    ************************************************************

HsCD00001581        TTGGACCCTCCCTTCGTTCCAGACCCCCGCGCTGTGTACTGTAAGGACGTGCTGGACATC
NM_005308.2         TTGGACCCTCCCTTCGTTCCAGACCCCCGCGCTGTGTACTGTAAGGACGTGCTGGACATC
XM_005269707.1      TTGGACCCTCCCTTCGTTCCAGACCCCCGCGCTGTGTACTGTAAGGACGTGCTGGACATC
XM_005269708.1      TTGGACCCTCCCTTCGTTCCAGACCCCCGCGCTGTGTACTGTAAGGACGTGCTGGACATC
                    ************************************************************

HsCD00001581        GAGCAGTTCTCCACTGTGAAGGGCGTCAATCTGGACCACACAGACGACGACTTCTACTCC
NM_005308.2         GAGCAGTTCTCCACTGTGAAGGGCGTCAATCTGGACCACACAGACGACGACTTCTACTCC
XM_005269707.1      GAGCAGTTCTCCACTGTGAAGGGCGTCAATCTGGACCACACAGACGACGACTTCTACTCC
XM_005269708.1      GAGCAGTTCTCCACTGTGAAGGGCGTCAATCTGGACCACACAGACGACGACTTCTACTCC
                    ************************************************************

HsCD00001581        AAGTTCTCCACGGGCTCTGTGTCCATCCCATGGCAAAACGAGATGATAGAAACAGAATGC
NM_005308.2         AAGTTCTCCACGGGCTCTGTGTCCATCCCATGGCAAAACGAGATGATAGAAACAGAATGC
XM_005269707.1      AAGTTCTCCACGGGCTCTGTGTCCATCCCATGGCAAAACGAGATGATAGAAACAGAATGC
XM_005269708.1      AAGTTCTCCACGGGCTCTGTGTCCATCCCATGGCAAAACGAGATGATAGAAACAGAATGC
                    ************************************************************

HsCD00001581        TTTAAGGAGCTGAACGTGTTTGGACCTAATGGTACCCTCCCGCCAGATCTGAACAGAAAC
NM_005308.2         TTTAAGGAGCTGAACGTGTTTGGACCTAATGGTACCCTCCCGCCAGATCTGAACAGAAAC
XM_005269707.1      TTTAAGGAGCTGAACGTGTTTGGACCTAATGGTACCCTCCCGCCAGATCTGAACAGAAAC
XM_005269708.1      TTTAAGGAGCTGAACGTGTTTGGACCTAATGGTACCCTCCCGCCAGATCTGAACAGAAAC
                    ************************************************************

HsCD00001581        CACCCTCCGGAACCGCCCAAGAAAGGGCTGCTCCAGAGACTCTTCAAGCGGCAGCATCAG
NM_005308.2         CACCCTCCGGAACCGCCCAAGAAAGGGCTGCTCCAGAGACTCTTCAAGCGGCAGCATCAG
XM_005269707.1      CACCCTCCGGAACCGCCCAAGAAAGGGCTGCTCCAGAGACTCTTCAAGCGGCAGCATCAG
XM_005269708.1      CACCCTCCGGAACCGCCCAAGAAAGGGCTGCTCCAGAGACTCTTCAAGCGGCAGCATCAG
                    ************************************************************

HsCD00001581        AACAATTCCAAGAGTTCGCCCAGCTCCAAGACCAGTTTTAACCACCACATAAACTCAAAC
NM_005308.2         AACAATTCCAAGAGTTCGCCCAGCTCCAAGACCAGTTTTAACCACCACATAAACTCAAAC
XM_005269707.1      AACAATTCCAAGAGTTCGCCCAGCTCCAAGACCAGTTTTAACCACCACATAAACTCAAAC
XM_005269708.1      AACAATTCCAAGAGTTCGCCCAGCTCCAAGACCAGTTTTAACCACCACATAAACTCAAAC
                    ************************************************************

HsCD00001581        CATGTCAGCTCGAACTCCACCGGAAGCAGCTTG
NM_005308.2         CATGTCAGCTCGAACTCCACCGGAAGCAGCTAG
XM_005269707.1      CATGTCAGCTCGAACTCCACCGGAAGCAGCTAG
XM_005269708.1      CATGTCAGCTCGAACTCCACCGGAAGCAGCTAG
                    *******************************:*

Pathways

NCI : Alpha-synuclein signaling
Panther : Angiotensin II-stimulated signaling through G proteins and beta-arrestin
Panther : Heterotrimeric G-protein signaling pathway-Gi alpha and Gs alpha mediated pathway
Panther : Heterotrimeric G-protein signaling pathway-Gq alpha and Go alpha mediated pathway
Reactome : G alpha (q) signalling events
Reactome : GPCR downstream signaling
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Signal Transduction
Reactome : Signaling by GPCR
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : Myometrial Relaxation and Contraction Pathways

Clone

Cloning Information : 161
HIP Master Clone ID : 87220
Original Clone ID : FLH000161.01L

Organism


TAX_ID : 9606
Species Specific ID: 2869

Genome

Chromosome : 10
Map Location : 10q26.11
Ensembl : ENSG00000198873

Reagents

Labome : GRK5-antibody