DNASU Plasmid Repository • 480.965.5697 | Email

RPS6KA6 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RPS6KA6
Gene Name:  ribosomal protein S6 kinase, 90kDa, polypeptide 6
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH000275.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00001625

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2238nts         Open reading frame : 1 to 2238
Reference Sequence Alignment

ATGCTACCATTCGCTCCTCAGGACGAGCCCTGGGACCGAGAAATGGAAGTGTTCAGCGGC
GGCGGCGCGAGCAGCGGCGAGGTAAATGGTCTTAAAATGGTTGATGAGCCAATGGAAGAG
GGAGAAGCAGATTCTTGTCATGATGAAGGAGTTGTTAAAGAAATCCCTATTACTCATCAT
GTTAAGGAAGGCTATGAGAAAGCAGATCCTGCACAGTTTGAGTTGCTCAAGGTTCTTGGT
CAGGGGTCATTTGGAAAGGTTTTTCTTGTTAGAAAGAAGACCGGTCCTGATGCTGGGCAG
CTCTATGCAATGAAGGTGTTAAAAAAAGCCTCTTTAAAAGTTCGAGACAGAGTTCGGACA
AAGATGGAGAGGGATATACTGGTGGAAGTAAATCATCCATTTATTGTCAAATTGCACTAT
GCCTTTCAGACTGAAGGGAAACTGTACTTAATACTGGATTTTCTCAGGGGAGGAGATGTT
TTCACAAGATTATCCAAAGAGGTTCTGTTTACAGAGGAAGATGTGAAATTCTACCTCGCA
GAACTGGCCCTTGCTTTGGATCATCTGCACCAATTAGGAATTGTTTATAGAGACCTGAAG
CCAGAAAACATTTTGCTTGATGAAATAGGACATATCAAATTAACAGATTTTGGACTCAGC
AAGGAGTCAGTAGATCAAGAAAAGAAGGCTTACTCATTTTGTGGTACAGTAGAGTATATG
GCTCCTGAAGTAGTAAATAGGAGAGGCCATTCCCAGAGTGCTGATTGGTGGTCATATGGT
GTTCTTATGTTTGAAATGCTTACTGGTACTCTGCCATTTCAAGGTAAAGACAGAAATGAG
ACCATGAATATGATATTAAAAGCAAAACTTGGAATGCCTCAATTTCTTAGTGCTGAAGCA
CAAAGTCTTCTAAGGATGTTATTCAAAAGGAATCCAGCAAATAGATTGGGATCAGAAGGA
GTTGAAGAAATCAAAAGACATCTGTTTTTTGCAAATATTGACTGGGATAAATTATATAAA
AGAGAAGTTCAACCTCCTTTCAAACCTGCTTCTGGAAAACCAGATGATACTTTTTGTTTT
GATCCTGAATTTACTGCAAAAACACCTAAAGATTCTCCCGGTTTGCCAGCCAGTGCAAAT
GCTCATCAGCTCTTCAAAGGATTCAGCTTTGTTGCAACTTCTATTGCAGAAGAATATAAA
ATCACTCCTATCACAAGTGCAAATGTATTACCAATTGTTCAGATAAATGGAAATGCTGCA
CAATTTGGTGAAGTATATGAATTGAAGGAGGATATTGGTGTTGGCTCCTACTCTGTTTGC
AAGCGATGCATACATGCAACTACCAACATGGAATTTGCAGTGAAGATCATTGACAAAAGT
AAGCGAGACCCTTCAGAAGAGATTGAAATATTGATGCGCTATGGACAACATCCCAACATT
ATTACTTTGAAGGATGTCTTTGATGATGGTAGATATGTTTACCTTGTTACGGATTTAATG
AAAGGAGGAGAGTTACTTGACCGTATTCTCAAACAAAAATGTTTCTCGGAACGGGAGGCT
AGTGATATACTATATGTAATAAGTAAGACAGTTGACTATCTTCATTGTCAAGGAGTTGTT
CATCGTGATCTTAAACCTAGTAATATTTTATACATGGATGAATCAGCCAGTGCAGATTCA
ATCAGGATATGTGATTTTGGGTTTGCAAAACAACTTCGAGGAGAAAATGGACTTCTCTTA
ACTCCATGCTACACTGCAAACTTTGTTGCACCTGAGGTTCTTATGCAACAGGGATATGAT
GCTGCTTGTGATATCTGGAGTTTAGGAGTCCTTTTTTACACAATGTTGGCTGGCTACACT
CCATTTGCTAATGGCCCCAATGATACTCCTGAAGAGATACTGCTGCGTATAGGCAATGGA
AAATTCTCTTTGAGTGGTGGAAACTGGGACAATATTTCAGACGGAGCAAAGGATTTGCTT
TCCCATATGCTTCATATGGACCCACATCAGCGGTATACTGCTGAACAAATATTAAAGCAC
TCATGGATAACTCACAGAGACCAGTTGCCAAATGATCAGCCAAAGAGAAATGATGTGTCA
CATGTTGTTAAGGGAGCAATGGTTGCAACATACTCTGCCCTGACTCACAAGACCTTTCAA
CCAGTCCTAGAGCCTGTAGCTGCTTCAAGCTTAGCCCAGCGACGGAGCATGAAAAAGCGA
ACATCAACTGGCCTGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2318
Start on reference sequence 81
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RPS6KA6
Symbol Nomenclature : RPS6KA6
SYNONYM : PP90RSK4; RSK4
Designation : 90 kDa ribosomal protein S6 kinase 6|RSK-4|S6K-alpha 6|S6K-alpha-6|p90-RSK 6|p90RSK6|ribosomal S6 kinase 4|ribosomal protein S6 kinase alpha-6
Full Nomenclature : ribosomal protein S6 kinase, 90kDa, polypeptide 6
GENEID : 27330
GI : 33303996
GenBank Accession : AY335679
HGNC : 10435
MIM : 300303
Target GenBank: NM_014496

 

Reference Sequence Alignment

  

HsCD00001625      ATGCTACCATTCGCTCCTCAGGACGAGCCCTGGGACCGAGAAATGGAAGTGTTCAGCGGC
NM_014496.4       ATGCTACCATTCGCTCCTCAGGACGAGCCCTGGGACCGAGAAATGGAAGTGTTCAGCGGC
                  ************************************************************

HsCD00001625      GGCGGCGCGAGCAGCGGCGAGGTAAATGGTCTTAAAATGGTTGATGAGCCAATGGAAGAG
NM_014496.4       GGCGGCGCGAGCAGCGGCGAGGTAAATGGTCTTAAAATGGTTGATGAGCCAATGGAAGAG
                  ************************************************************

HsCD00001625      GGAGAAGCAGATTCTTGTCATGATGAAGGAGTTGTTAAAGAAATCCCTATTACTCATCAT
NM_014496.4       GGAGAAGCAGATTCTTGTCATGATGAAGGAGTTGTTAAAGAAATCCCTATTACTCATCAT
                  ************************************************************

HsCD00001625      GTTAAGGAAGGCTATGAGAAAGCAGATCCTGCACAGTTTGAGTTGCTCAAGGTTCTTGGT
NM_014496.4       GTTAAGGAAGGCTATGAGAAAGCAGATCCTGCACAGTTTGAGTTGCTCAAGGTTCTTGGT
                  ************************************************************

HsCD00001625      CAGGGGTCATTTGGAAAGGTTTTTCTTGTTAGAAAGAAGACCGGTCCTGATGCTGGGCAG
NM_014496.4       CAGGGGTCATTTGGAAAGGTTTTTCTTGTTAGAAAGAAGACCGGTCCTGATGCTGGGCAG
                  ************************************************************

HsCD00001625      CTCTATGCAATGAAGGTGTTAAAAAAAGCCTCTTTAAAAGTTCGAGACAGAGTTCGGACA
NM_014496.4       CTCTATGCAATGAAGGTGTTAAAAAAAGCCTCTTTAAAAGTTCGAGACAGAGTTCGGACA
                  ************************************************************

HsCD00001625      AAGATGGAGAGGGATATACTGGTGGAAGTAAATCATCCATTTATTGTCAAATTGCACTAT
NM_014496.4       AAGATGGAGAGGGATATACTGGTGGAAGTAAATCATCCATTTATTGTCAAATTGCACTAT
                  ************************************************************

HsCD00001625      GCCTTTCAGACTGAAGGGAAACTGTACTTAATACTGGATTTTCTCAGGGGAGGAGATGTT
NM_014496.4       GCCTTTCAGACTGAAGGGAAACTGTACTTAATACTGGATTTTCTCAGGGGAGGAGATGTT
                  ************************************************************

HsCD00001625      TTCACAAGATTATCCAAAGAGGTTCTGTTTACAGAGGAAGATGTGAAATTCTACCTCGCA
NM_014496.4       TTCACAAGATTATCCAAAGAGGTTCTGTTTACAGAGGAAGATGTGAAATTCTACCTCGCA
                  ************************************************************

HsCD00001625      GAACTGGCCCTTGCTTTGGATCATCTGCACCAATTAGGAATTGTTTATAGAGACCTGAAG
NM_014496.4       GAACTGGCCCTTGCTTTGGATCATCTGCACCAATTAGGAATTGTTTATAGAGACCTGAAG
                  ************************************************************

HsCD00001625      CCAGAAAACATTTTGCTTGATGAAATAGGACATATCAAATTAACAGATTTTGGACTCAGC
NM_014496.4       CCAGAAAACATTTTGCTTGATGAAATAGGACATATCAAATTAACAGATTTTGGACTCAGC
                  ************************************************************

HsCD00001625      AAGGAGTCAGTAGATCAAGAAAAGAAGGCTTACTCATTTTGTGGTACAGTAGAGTATATG
NM_014496.4       AAGGAGTCAGTAGATCAAGAAAAGAAGGCTTACTCATTTTGTGGTACAGTAGAGTATATG
                  ************************************************************

HsCD00001625      GCTCCTGAAGTAGTAAATAGGAGAGGCCATTCCCAGAGTGCTGATTGGTGGTCATATGGT
NM_014496.4       GCTCCTGAAGTAGTAAATAGGAGAGGCCATTCCCAGAGTGCTGATTGGTGGTCATATGGT
                  ************************************************************

HsCD00001625      GTTCTTATGTTTGAAATGCTTACTGGTACTCTGCCATTTCAAGGTAAAGACAGAAATGAG
NM_014496.4       GTTCTTATGTTTGAAATGCTTACTGGTACTCTGCCATTTCAAGGTAAAGACAGAAATGAG
                  ************************************************************

HsCD00001625      ACCATGAATATGATATTAAAAGCAAAACTTGGAATGCCTCAATTTCTTAGTGCTGAAGCA
NM_014496.4       ACCATGAATATGATATTAAAAGCAAAACTTGGAATGCCTCAATTTCTTAGTGCTGAAGCA
                  ************************************************************

HsCD00001625      CAAAGTCTTCTAAGGATGTTATTCAAAAGGAATCCAGCAAATAGATTGGGATCAGAAGGA
NM_014496.4       CAAAGTCTTCTAAGGATGTTATTCAAAAGGAATCCAGCAAATAGATTGGGATCAGAAGGA
                  ************************************************************

HsCD00001625      GTTGAAGAAATCAAAAGACATCTGTTTTTTGCAAATATTGACTGGGATAAATTATATAAA
NM_014496.4       GTTGAAGAAATCAAAAGACATCTGTTTTTTGCAAATATTGACTGGGATAAATTATATAAA
                  ************************************************************

HsCD00001625      AGAGAAGTTCAACCTCCTTTCAAACCTGCTTCTGGAAAACCAGATGATACTTTTTGTTTT
NM_014496.4       AGAGAAGTTCAACCTCCTTTCAAACCTGCTTCTGGAAAACCAGATGATACTTTTTGTTTT
                  ************************************************************

HsCD00001625      GATCCTGAATTTACTGCAAAAACACCTAAAGATTCTCCCGGTTTGCCAGCCAGTGCAAAT
NM_014496.4       GATCCTGAATTTACTGCAAAAACACCTAAAGATTCTCCCGGTTTGCCAGCCAGTGCAAAT
                  ************************************************************

HsCD00001625      GCTCATCAGCTCTTCAAAGGATTCAGCTTTGTTGCAACTTCTATTGCAGAAGAATATAAA
NM_014496.4       GCTCATCAGCTCTTCAAAGGATTCAGCTTTGTTGCAACTTCTATTGCAGAAGAATATAAA
                  ************************************************************

HsCD00001625      ATCACTCCTATCACAAGTGCAAATGTATTACCAATTGTTCAGATAAATGGAAATGCTGCA
NM_014496.4       ATCACTCCTATCACAAGTGCAAATGTATTACCAATTGTTCAGATAAATGGAAATGCTGCA
                  ************************************************************

HsCD00001625      CAATTTGGTGAAGTATATGAATTGAAGGAGGATATTGGTGTTGGCTCCTACTCTGTTTGC
NM_014496.4       CAATTTGGTGAAGTATATGAATTGAAGGAGGATATTGGTGTTGGCTCCTACTCTGTTTGC
                  ************************************************************

HsCD00001625      AAGCGATGCATACATGCAACTACCAACATGGAATTTGCAGTGAAGATCATTGACAAAAGT
NM_014496.4       AAGCGATGCATACATGCAACTACCAACATGGAATTTGCAGTGAAGATCATTGACAAAAGT
                  ************************************************************

HsCD00001625      AAGCGAGACCCTTCAGAAGAGATTGAAATATTGATGCGCTATGGACAACATCCCAACATT
NM_014496.4       AAGCGAGACCCTTCAGAAGAGATTGAAATATTGATGCGCTATGGACAACATCCCAACATT
                  ************************************************************

HsCD00001625      ATTACTTTGAAGGATGTCTTTGATGATGGTAGATATGTTTACCTTGTTACGGATTTAATG
NM_014496.4       ATTACTTTGAAGGATGTCTTTGATGATGGTAGATATGTTTACCTTGTTACGGATTTAATG
                  ************************************************************

HsCD00001625      AAAGGAGGAGAGTTACTTGACCGTATTCTCAAACAAAAATGTTTCTCGGAACGGGAGGCT
NM_014496.4       AAAGGAGGAGAGTTACTTGACCGTATTCTCAAACAAAAATGTTTCTCGGAACGGGAGGCT
                  ************************************************************

HsCD00001625      AGTGATATACTATATGTAATAAGTAAGACAGTTGACTATCTTCATTGTCAAGGAGTTGTT
NM_014496.4       AGTGATATACTATATGTAATAAGTAAGACAGTTGACTATCTTCATTGTCAAGGAGTTGTT
                  ************************************************************

HsCD00001625      CATCGTGATCTTAAACCTAGTAATATTTTATACATGGATGAATCAGCCAGTGCAGATTCA
NM_014496.4       CATCGTGATCTTAAACCTAGTAATATTTTATACATGGATGAATCAGCCAGTGCAGATTCA
                  ************************************************************

HsCD00001625      ATCAGGATATGTGATTTTGGGTTTGCAAAACAACTTCGAGGAGAAAATGGACTTCTCTTA
NM_014496.4       ATCAGGATATGTGATTTTGGGTTTGCAAAACAACTTCGAGGAGAAAATGGACTTCTCTTA
                  ************************************************************

HsCD00001625      ACTCCATGCTACACTGCAAACTTTGTTGCACCTGAGGTTCTTATGCAACAGGGATATGAT
NM_014496.4       ACTCCATGCTACACTGCAAACTTTGTTGCACCTGAGGTTCTTATGCAACAGGGATATGAT
                  ************************************************************

HsCD00001625      GCTGCTTGTGATATCTGGAGTTTAGGAGTCCTTTTTTACACAATGTTGGCTGGCTACACT
NM_014496.4       GCTGCTTGTGATATCTGGAGTTTAGGAGTCCTTTTTTACACAATGTTGGCTGGCTACACT
                  ************************************************************

HsCD00001625      CCATTTGCTAATGGCCCCAATGATACTCCTGAAGAGATACTGCTGCGTATAGGCAATGGA
NM_014496.4       CCATTTGCTAATGGCCCCAATGATACTCCTGAAGAGATACTGCTGCGTATAGGCAATGGA
                  ************************************************************

HsCD00001625      AAATTCTCTTTGAGTGGTGGAAACTGGGACAATATTTCAGACGGAGCAAAGGATTTGCTT
NM_014496.4       AAATTCTCTTTGAGTGGTGGAAACTGGGACAATATTTCAGACGGAGCAAAGGATTTGCTT
                  ************************************************************

HsCD00001625      TCCCATATGCTTCATATGGACCCACATCAGCGGTATACTGCTGAACAAATATTAAAGCAC
NM_014496.4       TCCCATATGCTTCATATGGACCCACATCAGCGGTATACTGCTGAACAAATATTAAAGCAC
                  ************************************************************

HsCD00001625      TCATGGATAACTCACAGAGACCAGTTGCCAAATGATCAGCCAAAGAGAAATGATGTGTCA
NM_014496.4       TCATGGATAACTCACAGAGACCAGTTGCCAAATGATCAGCCAAAGAGAAATGATGTGTCA
                  ************************************************************

HsCD00001625      CATGTTGTTAAGGGAGCAATGGTTGCAACATACTCTGCCCTGACTCACAAGACCTTTCAA
NM_014496.4       CATGTTGTTAAGGGAGCAATGGTTGCAACATACTCTGCCCTGACTCACAAGACCTTTCAA
                  ************************************************************

HsCD00001625      CCAGTCCTAGAGCCTGTAGCTGCTTCAAGCTTAGCCCAGCGACGGAGCATGAAAAAGCGA
NM_014496.4       CCAGTCCTAGAGCCTGTAGCTGCTTCAAGCTTAGCCCAGCGACGGAGCATGAAAAAGCGA
                  ************************************************************

HsCD00001625      ACATCAACTGGCCTGTTG
NM_014496.4       ACATCAACTGGCCTGTAA
                  ****************:.

Pathways

Panther : Insulin/IGF pathway-mitogen activated protein kinase kinase/MAP kinase cascade
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
Panther : Ras Pathway
Reactome : Activation of NMDA receptor upon glutamate binding and postsynaptic events
Reactome : Axon guidance
Reactome : CREB phosphorylation through the activation of Ras
Reactome : Developmental Biology
Reactome : L1CAM interactions
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Post NMDA receptor activation events
Reactome : RSK activation
Reactome : Recycling pathway of L1
Reactome : Transmission across Chemical Synapses
WikiPathway : Cytoplasmic Ribosomal Proteins
WikiPathway : Insulin Signaling

Clone

Cloning Information : 275
HIP Master Clone ID : 87316
Original Clone ID : FLH000275.01L

Organism


TAX_ID : 9606
Species Specific ID: 27330

Genome

Chromosome : X
Map Location : Xq21

Reagents

Labome : RSK4-antibody