DNASU Plasmid Repository • 480.965.5697 | Email

PIK3CB (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PIK3CB
Gene Name:  phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH000259.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00001636

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3213nts         Open reading frame : 1 to 3213
Reference Sequence Alignment

ATGTGCTTCAGTTTCATAATGCCTCCTGCTATGGCAGACATCCTTGACATCTGGGCGGTG
GATTCACAGATAGCATCTGATGGCTCCATACCTGTGGATTTCCTTTTGCCCACTGGGATT
TATATCCAGTTGGAGGTACCTCGGGAAGCTACCATTTCTTATATTAAGCAGATGTTATGG
AAGCAAGTTCACAATTACCCAATGTTCAACCTCCTTATGGATATTGACTCCTATATGTTT
GCATGTGTGAATCAGACTGCTGTATATGAGGAGCTTGAAGATGAAACACGAAGACTCTGT
GATGTCAGACCTTTTCTTCCAGTTCTCAAATTAGTGACAAGAAGTTGTGACCCAGGGGAA
AAATTAGACTCAAAAATTGGAGTCCTTATAGGAAAAGGTCTGCATGAATTTGATTCCTTG
AAGGATCCTGAAGTAAATGAATTTCGAAGAAAAATGCGCAAATTCAGCGAGGAAAAAATC
CTGTCACTTGTGGGATTGTCTTGGATGGACTGGCTAAAACAAACATATCCACCAGAGCAT
GAACCATCCATCCCTGAAAACTTAGAAGATAAACTTTATGGGGGAAAGCTCATCGTAGCT
GTTCATTTTGAAAACTGCCAGGACGTGTTTAGCTTTCAAGTGTCTCCTAATATGAATCCT
ATCAAAGTAAATGAATTGGCAATCCAAAAACGTTTGACTATTCATGGGAAGGAAGATGAA
GTTAGCCCCTATGATTATGTGTTGCAAGTCAGCGGGAGAGTAGAATATGTTTTTGGTGAT
CATCCACTAATTCAGTTCCAGTATATCCGGAACTGTGTGATGAACAGAGCCCTGCCCCAT
TTTATACTTGTGGAATGCTGCAAGATCAAGAAAATGTATGAACAAGAAATGATTGCCATA
GAGGCTGCCATAAATCGAAATTCATCTAATCTTCCTCTTCCATTACCACCAAAGAAAACA
CGAATTATTTCTCATGTTTGGGAAAATAACAACCCTTTCCAAATTGTCTTGGTTAAGGGA
AATAAACTTAACACAGAGGAAACTGTAAAAGTTCATGTCAGGGCTGGTCTTTTTCATGGT
ACTGAGCTCCTGTGTAAAACCATCGTAAGCTCAGAGGTATCAGGGAAAAATGATCATATT
TGGAATGAACCACTGGAATTTGATATTAATATTTGTGACTTACCAAGAATGGCTCGATTA
TGTTTTGCTGTTTATGCAGTTTTGGATAAAGTAAAAACGAAGAAATCAACGAAAACTATT
AATCCCTCTAAATATCAGACCATCAGGAAAGCTGGAAAAGTGCATTATCCTGTAGCGTGG
GTAAATACGATGGTTTTTGACTTTAAAGGACAATTGAGAACTGGAGACATAATATTACAC
AGCTGGTCTTCATTTCCTGATGAACTCGAAGAAATGTTGAATCCAATGGGAACTGTTCAA
ACAAATCCATATACTGAAAATGCAACAGCTTTGCATGTTAAATTTCCAGAGAATAAAAAA
CAACCTTATTATTACCCTCCCTTCGATAAGATTATTGAAAAGGCAGCTGAGATTGCAAGC
AGTGATAGTGCTAATGTGTCAAGTCGAGGTGGAAAAAAGTTTCTTCCTGTATTGAAAGAA
ATCTTGGACAGGGATCCCTTGTCTCAACTGTGTGAAAATGAAATGGATCTTATTTGGACT
TTGCGACAAGACTGCCGAGAGATTTTCCCACAATCACTGCCAAAATTACTGCTGTCAATC
AAGTGGAATAAACTTGAGGATGTTGCTCAGCTTCAGGCGCTGCTTCAGATTTGGCCTAAA
CTGCCCCCCCGGGAGGCCCTAGAGCTTCTGGATTTCAACTATCCAGACCAGTACGTTCGA
GAATATGCTGTAGGCTGCCTGCGACAGATGAGTGATGAAGAACTTTCTCAATATCTTTTA
CAACTGGTGCAAGTGTTAAAATATGAGCCTTTTCTTGATTGTGCCCTCTCTAGATTCCTA
TTAGAAAGAGCACTTGGTAATCGGAGGATAGGGCAGTTTCTATTTTGGCATCTTAGGTCA
GAAGTGCACATTCCTGCTGTCTCAGTACAATTTGGTGTCATCCTTGAAGCATACTGCCGG
GGAAGTGTGGGGCACATGAAAGTGCTTTCTAAGCAGGTTGAAGCACTCAATAAGTTAAAA
ACTTTAAATAGTTTAATCAAACTGAATGCCGTGAAGTTAAACAGAGCCAAAGGGAAGGAG
GCCATGCATACCTGTTTAAAACAGAGTGCTTACCGGGAAGCCCTCTCTGACCTGCAGTCA
CCCCTGAACCCATGTGTTATCCTCTCAGAACTCTATGTTGAAAAGTGCAAATACATGGAT
TCCAAAATGAAGCCTTTGTGGCTGGTATACAATAACAAGGTATTTGGTGAGGATTCAGTT
GGAGTGATTTTTAAAAATGGTGATGATTTACGACAGGATATGTTGACACTCCAAATGTTG
CGCTTGATGGATTTACTCTGGAAAGAAGCTGGTTTGGATCTTCGGATGTTGCCTTATGGC
TGTTTAGCAACAGGAGATCGCTCTGGCCTCATTGAAGTTGTGAGCACCTCTGAAACAATT
GCTGACATTCAGCTGAACAGTAGCAATGTGGCTGCTGCAGCAGCCTTCAACAAAGATGCC
CTTCTGAACTGGCTTAAAGAATACAACTCTGGGGATGACCTGGACCGAGCCATTGAGGAA
TTTACACTGTCCTGTGCTGGCTACTGTGTAGCTTCTTATGTCCTTGGGATTGGTGACAGA
CATAGTGACAACATCATGGTCAAAAAAACTGGCCAGCTCTTCCACATTGACTTTGGACAT
ATTCTTGGAAATTTCAAATCTAAGTTTGGCATTAAAAGGGAGCGAGTGCCTTTTATTCTT
ACCTATGATTTCATCCATGTCATTCAACAAGGAAAAACAGGAAATACAGAAAAGTTTGGC
CGGTTCCGCCAGTGTTGTGAGGATGCATATCTGATTTTACGACGGCATGGGAATCTCTTC
ATCACTCTCTTTGCGCTGATGTTGACTGCAGGGCTTCCTGAACTCACATCAGTCAAAGAT
ATACAGTATCTTAAGGACTCTCTTGCATTAGGGAAGAGTGAAGAAGAAGCACTCAAACAG
TTTAAGCAAAAATTTGATGAGGCGCTCAGGGAAAGCTGGACTACTAAAGTGAACTGGATG
GCCCACACAGTTCGGAAAGACTACAGATCTTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 3213
Start on reference sequence 1
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PIK3CB
Symbol Nomenclature : PIK3CB
SYNONYM : P110BETA; PI3K; PI3KBETA; PIK3C1
Designation : PI3-kinase p110 subunit beta|PI3-kinase subunit beta|PI3K-beta|PtdIns-3-kinase p110|phosphatidylinositol 4,5-bisphosphate 3-kinase 110 kDa catalytic subunit beta|phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit beta isoform|phosphatidylinositol-4,5-bisphosphate 3-kinase 110 kDa catalytic subunit beta|phosphoinositide-3-kinase, catalytic, beta polypeptide|ptdIns-3-kinase subunit beta|ptdIns-3-kinase subunit p110-beta
Full Nomenclature : phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
GENEID : 5291
GI : 33304014
GenBank Accession : AY335688
HGNC : 8976
MIM : 602925
Target GenBank: NM_006219

 

Reference Sequence Alignment

  

HsCD00001636        ATGTGCTTCAGTTTCATAATGCCTCCTGCTATGGCAGACATCCTTGACATCTGGGCGGTG
XM_005247532.1      ATGTGCTTCAGTTTCATAATGCCTCCTGCTATGGCAGACATCCTTGACATCTGGGCGGTG
XM_005247530.1      ATGTGCTTCAGTTTCATAATGCCTCCTGCTATGGCAGACATCCTTGACATCTGGGCGGTG
NM_006219.2         ATGTGCTTCAGTTTCATAATGCCTCCTGCTATGGCAGACATCCTTGACATCTGGGCGGTG
XM_005247531.1      ATGTGCTTCAGTTTCATAATGCCTCCTGCTATGGCAGACATCCTTGACATCTGGGCGGTG
                    ************************************************************

HsCD00001636        GATTCACAGATAGCATCTGATGGCTCCATACCTGTGGATTTCCTTTTGCCCACTGGGATT
XM_005247532.1      GATTCACAGATAGCATCTGATGGCTCCATACCTGTGGATTTCCTTTTGCCCACTGGGATT
XM_005247530.1      GATTCACAGATAGCATCTGATGGCTCCATACCTGTGGATTTCCTTTTGCCCACTGGGATT
NM_006219.2         GATTCACAGATAGCATCTGATGGCTCCATACCTGTGGATTTCCTTTTGCCCACTGGGATT
XM_005247531.1      GATTCACAGATAGCATCTGATGGCTCCATACCTGTGGATTTCCTTTTGCCCACTGGGATT
                    ************************************************************

HsCD00001636        TATATCCAGTTGGAGGTACCTCGGGAAGCTACCATTTCTTATATTAAGCAGATGTTATGG
XM_005247532.1      TATATCCAGTTGGAGGTACCTCGGGAAGCTACCATTTCTTATATTAAGCAGATGTTATGG
XM_005247530.1      TATATCCAGTTGGAGGTACCTCGGGAAGCTACCATTTCTTATATTAAGCAGATGTTATGG
NM_006219.2         TATATCCAGTTGGAGGTACCTCGGGAAGCTACCATTTCTTATATTAAGCAGATGTTATGG
XM_005247531.1      TATATCCAGTTGGAGGTACCTCGGGAAGCTACCATTTCTTATATTAAGCAGATGTTATGG
                    ************************************************************

HsCD00001636        AAGCAAGTTCACAATTACCCAATGTTCAACCTCCTTATGGATATTGACTCCTATATGTTT
XM_005247532.1      AAGCAAGTTCACAATTACCCAATGTTCAACCTCCTTATGGATATTGACTCCTATATGTTT
XM_005247530.1      AAGCAAGTTCACAATTACCCAATGTTCAACCTCCTTATGGATATTGACTCCTATATGTTT
NM_006219.2         AAGCAAGTTCACAATTACCCAATGTTCAACCTCCTTATGGATATTGACTCCTATATGTTT
XM_005247531.1      AAGCAAGTTCACAATTACCCAATGTTCAACCTCCTTATGGATATTGACTCCTATATGTTT
                    ************************************************************

HsCD00001636        GCATGTGTGAATCAGACTGCTGTATATGAGGAGCTTGAAGATGAAACACGAAGACTCTGT
XM_005247532.1      GCATGTGTGAATCAGACTGCTGTATATGAGGAGCTTGAAGATGAAACACGAAGACTCTGT
XM_005247530.1      GCATGTGTGAATCAGACTGCTGTATATGAGGAGCTTGAAGATGAAACACGAAGACTCTGT
NM_006219.2         GCATGTGTGAATCAGACTGCTGTATATGAGGAGCTTGAAGATGAAACACGAAGACTCTGT
XM_005247531.1      GCATGTGTGAATCAGACTGCTGTATATGAGGAGCTTGAAGATGAAACACGAAGACTCTGT
                    ************************************************************

HsCD00001636        GATGTCAGACCTTTTCTTCCAGTTCTCAAATTAGTGACAAGAAGTTGTGACCCAGGGGAA
XM_005247532.1      GATGTCAGACCTTTTCTTCCAGTTCTCAAATTAGTGACAAGAAGTTGTGACCCAGGGGAA
XM_005247530.1      GATGTCAGACCTTTTCTTCCAGTTCTCAAATTAGTGACAAGAAGTTGTGACCCAGGGGAA
NM_006219.2         GATGTCAGACCTTTTCTTCCAGTTCTCAAATTAGTGACAAGAAGTTGTGACCCAGGGGAA
XM_005247531.1      GATGTCAGACCTTTTCTTCCAGTTCTCAAATTAGTGACAAGAAGTTGTGACCCAGGGGAA
                    ************************************************************

HsCD00001636        AAATTAGACTCAAAAATTGGAGTCCTTATAGGAAAAGGTCTGCATGAATTTGATTCCTTG
XM_005247532.1      AAATTAGACTCAAAAATTGGAGTCCTTATAGGAAAAGGTCTGCATGAATTTGATTCCTTG
XM_005247530.1      AAATTAGACTCAAAAATTGGAGTCCTTATAGGAAAAGGTCTGCATGAATTTGATTCCTTG
NM_006219.2         AAATTAGACTCAAAAATTGGAGTCCTTATAGGAAAAGGTCTGCATGAATTTGATTCCTTG
XM_005247531.1      AAATTAGACTCAAAAATTGGAGTCCTTATAGGAAAAGGTCTGCATGAATTTGATTCCTTG
                    ************************************************************

HsCD00001636        AAGGATCCTGAAGTAAATGAATTTCGAAGAAAAATGCGCAAATTCAGCGAGGAAAAAATC
XM_005247532.1      AAGGATCCTGAAGTAAATGAATTTCGAAGAAAAATGCGCAAATTCAGCGAGGAAAAAATC
XM_005247530.1      AAGGATCCTGAAGTAAATGAATTTCGAAGAAAAATGCGCAAATTCAGCGAGGAAAAAATC
NM_006219.2         AAGGATCCTGAAGTAAATGAATTTCGAAGAAAAATGCGCAAATTCAGCGAGGAAAAAATC
XM_005247531.1      AAGGATCCTGAAGTAAATGAATTTCGAAGAAAAATGCGCAAATTCAGCGAGGAAAAAATC
                    ************************************************************

HsCD00001636        CTGTCACTTGTGGGATTGTCTTGGATGGACTGGCTAAAACAAACATATCCACCAGAGCAT
XM_005247532.1      CTGTCACTTGTGGGATTGTCTTGGATGGACTGGCTAAAACAAACATATCCACCAGAGCAT
XM_005247530.1      CTGTCACTTGTGGGATTGTCTTGGATGGACTGGCTAAAACAAACATATCCACCAGAGCAT
NM_006219.2         CTGTCACTTGTGGGATTGTCTTGGATGGACTGGCTAAAACAAACATATCCACCAGAGCAT
XM_005247531.1      CTGTCACTTGTGGGATTGTCTTGGATGGACTGGCTAAAACAAACATATCCACCAGAGCAT
                    ************************************************************

HsCD00001636        GAACCATCCATCCCTGAAAACTTAGAAGATAAACTTTATGGGGGAAAGCTCATCGTAGCT
XM_005247532.1      GAACCATCCATCCCTGAAAACTTAGAAGATAAACTTTATGGGGGAAAGCTCATCGTAGCT
XM_005247530.1      GAACCATCCATCCCTGAAAACTTAGAAGATAAACTTTATGGGGGAAAGCTCATCGTAGCT
NM_006219.2         GAACCATCCATCCCTGAAAACTTAGAAGATAAACTTTATGGGGGAAAGCTCATCGTAGCT
XM_005247531.1      GAACCATCCATCCCTGAAAACTTAGAAGATAAACTTTATGGGGGAAAGCTCATCGTAGCT
                    ************************************************************

HsCD00001636        GTTCATTTTGAAAACTGCCAGGACGTGTTTAGCTTTCAAGTGTCTCCTAATATGAATCCT
XM_005247532.1      GTTCATTTTGAAAACTGCCAGGACGTGTTTAGCTTTCAAGTGTCTCCTAATATGAATCCT
XM_005247530.1      GTTCATTTTGAAAACTGCCAGGACGTGTTTAGCTTTCAAGTGTCTCCTAATATGAATCCT
NM_006219.2         GTTCATTTTGAAAACTGCCAGGACGTGTTTAGCTTTCAAGTGTCTCCTAATATGAATCCT
XM_005247531.1      GTTCATTTTGAAAACTGCCAGGACGTGTTTAGCTTTCAAGTGTCTCCTAATATGAATCCT
                    ************************************************************

HsCD00001636        ATCAAAGTAAATGAATTGGCAATCCAAAAACGTTTGACTATTCATGGGAAGGAAGATGAA
XM_005247532.1      ATCAAAGTAAATGAATTGGCAATCCAAAAACGTTTGACTATTCATGGGAAGGAAGATGAA
XM_005247530.1      ATCAAAGTAAATGAATTGGCAATCCAAAAACGTTTGACTATTCATGGGAAGGAAGATGAA
NM_006219.2         ATCAAAGTAAATGAATTGGCAATCCAAAAACGTTTGACTATTCATGGGAAGGAAGATGAA
XM_005247531.1      ATCAAAGTAAATGAATTGGCAATCCAAAAACGTTTGACTATTCATGGGAAGGAAGATGAA
                    ************************************************************

HsCD00001636        GTTAGCCCCTATGATTATGTGTTGCAAGTCAGCGGGAGAGTAGAATATGTTTTTGGTGAT
XM_005247532.1      GTTAGCCCCTATGATTATGTGTTGCAAGTCAGCGGGAGAGTAGAATATGTTTTTGGTGAT
XM_005247530.1      GTTAGCCCCTATGATTATGTGTTGCAAGTCAGCGGGAGAGTAGAATATGTTTTTGGTGAT
NM_006219.2         GTTAGCCCCTATGATTATGTGTTGCAAGTCAGCGGGAGAGTAGAATATGTTTTTGGTGAT
XM_005247531.1      GTTAGCCCCTATGATTATGTGTTGCAAGTCAGCGGGAGAGTAGAATATGTTTTTGGTGAT
                    ************************************************************

HsCD00001636        CATCCACTAATTCAGTTCCAGTATATCCGGAACTGTGTGATGAACAGAGCCCTGCCCCAT
XM_005247532.1      CATCCACTAATTCAGTTCCAGTATATCCGGAACTGTGTGATGAACAGAGCCCTGCCCCAT
XM_005247530.1      CATCCACTAATTCAGTTCCAGTATATCCGGAACTGTGTGATGAACAGAGCCCTGCCCCAT
NM_006219.2         CATCCACTAATTCAGTTCCAGTATATCCGGAACTGTGTGATGAACAGAGCCCTGCCCCAT
XM_005247531.1      CATCCACTAATTCAGTTCCAGTATATCCGGAACTGTGTGATGAACAGAGCCCTGCCCCAT
                    ************************************************************

HsCD00001636        TTTATACTTGTGGAATGCTGCAAGATCAAGAAAATGTATGAACAAGAAATGATTGCCATA
XM_005247532.1      TTTATACTTGTGGAATGCTGCAAGATCAAGAAAATGTATGAACAAGAAATGATTGCCATA
XM_005247530.1      TTTATACTTGTGGAATGCTGCAAGATCAAGAAAATGTATGAACAAGAAATGATTGCCATA
NM_006219.2         TTTATACTTGTGGAATGCTGCAAGATCAAGAAAATGTATGAACAAGAAATGATTGCCATA
XM_005247531.1      TTTATACTTGTGGAATGCTGCAAGATCAAGAAAATGTATGAACAAGAAATGATTGCCATA
                    ************************************************************

HsCD00001636        GAGGCTGCCATAAATCGAAATTCATCTAATCTTCCTCTTCCATTACCACCAAAGAAAACA
XM_005247532.1      GAGGCTGCCATAAATCGAAATTCATCTAATCTTCCTCTTCCATTACCACCAAAGAAAACA
XM_005247530.1      GAGGCTGCCATAAATCGAAATTCATCTAATCTTCCTCTTCCATTACCACCAAAGAAAACA
NM_006219.2         GAGGCTGCCATAAATCGAAATTCATCTAATCTTCCTCTTCCATTACCACCAAAGAAAACA
XM_005247531.1      GAGGCTGCCATAAATCGAAATTCATCTAATCTTCCTCTTCCATTACCACCAAAGAAAACA
                    ************************************************************

HsCD00001636        CGAATTATTTCTCATGTTTGGGAAAATAACAACCCTTTCCAAATTGTCTTGGTTAAGGGA
XM_005247532.1      CGAATTATTTCTCATGTTTGGGAAAATAACAACCCTTTCCAAATTGTCTTGGTTAAGGGA
XM_005247530.1      CGAATTATTTCTCATGTTTGGGAAAATAACAACCCTTTCCAAATTGTCTTGGTTAAGGGA
NM_006219.2         CGAATTATTTCTCATGTTTGGGAAAATAACAACCCTTTCCAAATTGTCTTGGTTAAGGGA
XM_005247531.1      CGAATTATTTCTCATGTTTGGGAAAATAACAACCCTTTCCAAATTGTCTTGGTTAAGGGA
                    ************************************************************

HsCD00001636        AATAAACTTAACACAGAGGAAACTGTAAAAGTTCATGTCAGGGCTGGTCTTTTTCATGGT
XM_005247532.1      AATAAACTTAACACAGAGGAAACTGTAAAAGTTCATGTCAGGGCTGGTCTTTTTCATGGT
XM_005247530.1      AATAAACTTAACACAGAGGAAACTGTAAAAGTTCATGTCAGGGCTGGTCTTTTTCATGGT
NM_006219.2         AATAAACTTAACACAGAGGAAACTGTAAAAGTTCATGTCAGGGCTGGTCTTTTTCATGGT
XM_005247531.1      AATAAACTTAACACAGAGGAAACTGTAAAAGTTCATGTCAGGGCTGGTCTTTTTCATGGT
                    ************************************************************

HsCD00001636        ACTGAGCTCCTGTGTAAAACCATCGTAAGCTCAGAGGTATCAGGGAAAAATGATCATATT
XM_005247532.1      ACTGAGCTCCTGTGTAAAACCATCGTAAGCTCAGAGGTATCAGGGAAAAATGATCATATT
XM_005247530.1      ACTGAGCTCCTGTGTAAAACCATCGTAAGCTCAGAGGTATCAGGGAAAAATGATCATATT
NM_006219.2         ACTGAGCTCCTGTGTAAAACCATCGTAAGCTCAGAGGTATCAGGGAAAAATGATCATATT
XM_005247531.1      ACTGAGCTCCTGTGTAAAACCATCGTAAGCTCAGAGGTATCAGGGAAAAATGATCATATT
                    ************************************************************

HsCD00001636        TGGAATGAACCACTGGAATTTGATATTAATATTTGTGACTTACCAAGAATGGCTCGATTA
XM_005247532.1      TGGAATGAACCACTGGAATTTGATATTAATATTTGTGACTTACCAAGAATGGCTCGATTA
XM_005247530.1      TGGAATGAACCACTGGAATTTGATATTAATATTTGTGACTTACCAAGAATGGCTCGATTA
NM_006219.2         TGGAATGAACCACTGGAATTTGATATTAATATTTGTGACTTACCAAGAATGGCTCGATTA
XM_005247531.1      TGGAATGAACCACTGGAATTTGATATTAATATTTGTGACTTACCAAGAATGGCTCGATTA
                    ************************************************************

HsCD00001636        TGTTTTGCTGTTTATGCAGTTTTGGATAAAGTAAAAACGAAGAAATCAACGAAAACTATT
XM_005247532.1      TGTTTTGCTGTTTATGCAGTTTTGGATAAAGTAAAAACGAAGAAATCAACGAAAACTATT
XM_005247530.1      TGTTTTGCTGTTTATGCAGTTTTGGATAAAGTAAAAACGAAGAAATCAACGAAAACTATT
NM_006219.2         TGTTTTGCTGTTTATGCAGTTTTGGATAAAGTAAAAACGAAGAAATCAACGAAAACTATT
XM_005247531.1      TGTTTTGCTGTTTATGCAGTTTTGGATAAAGTAAAAACGAAGAAATCAACGAAAACTATT
                    ************************************************************

HsCD00001636        AATCCCTCTAAATATCAGACCATCAGGAAAGCTGGAAAAGTGCATTATCCTGTAGCGTGG
XM_005247532.1      AATCCCTCTAAATATCAGACCATCAGGAAAGCTGGAAAAGTGCATTATCCTGTAGCGTGG
XM_005247530.1      AATCCCTCTAAATATCAGACCATCAGGAAAGCTGGAAAAGTGCATTATCCTGTAGCGTGG
NM_006219.2         AATCCCTCTAAATATCAGACCATCAGGAAAGCTGGAAAAGTGCATTATCCTGTAGCGTGG
XM_005247531.1      AATCCCTCTAAATATCAGACCATCAGGAAAGCTGGAAAAGTGCATTATCCTGTAGCGTGG
                    ************************************************************

HsCD00001636        GTAAATACGATGGTTTTTGACTTTAAAGGACAATTGAGAACTGGAGACATAATATTACAC
XM_005247532.1      GTAAATACGATGGTTTTTGACTTTAAAGGACAATTGAGAACTGGAGACATAATATTACAC
XM_005247530.1      GTAAATACGATGGTTTTTGACTTTAAAGGACAATTGAGAACTGGAGACATAATATTACAC
NM_006219.2         GTAAATACGATGGTTTTTGACTTTAAAGGACAATTGAGAACTGGAGACATAATATTACAC
XM_005247531.1      GTAAATACGATGGTTTTTGACTTTAAAGGACAATTGAGAACTGGAGACATAATATTACAC
                    ************************************************************

HsCD00001636        AGCTGGTCTTCATTTCCTGATGAACTCGAAGAAATGTTGAATCCAATGGGAACTGTTCAA
XM_005247532.1      AGCTGGTCTTCATTTCCTGATGAACTCGAAGAAATGTTGAATCCAATGGGAACTGTTCAA
XM_005247530.1      AGCTGGTCTTCATTTCCTGATGAACTCGAAGAAATGTTGAATCCAATGGGAACTGTTCAA
NM_006219.2         AGCTGGTCTTCATTTCCTGATGAACTCGAAGAAATGTTGAATCCAATGGGAACTGTTCAA
XM_005247531.1      AGCTGGTCTTCATTTCCTGATGAACTCGAAGAAATGTTGAATCCAATGGGAACTGTTCAA
                    ************************************************************

HsCD00001636        ACAAATCCATATACTGAAAATGCAACAGCTTTGCATGTTAAATTTCCAGAGAATAAAAAA
XM_005247532.1      ACAAATCCATATACTGAAAATGCAACAGCTTTGCATGTTAAATTTCCAGAGAATAAAAAA
XM_005247530.1      ACAAATCCATATACTGAAAATGCAACAGCTTTGCATGTTAAATTTCCAGAGAATAAAAAA
NM_006219.2         ACAAATCCATATACTGAAAATGCAACAGCTTTGCATGTTAAATTTCCAGAGAATAAAAAA
XM_005247531.1      ACAAATCCATATACTGAAAATGCAACAGCTTTGCATGTTAAATTTCCAGAGAATAAAAAA
                    ************************************************************

HsCD00001636        CAACCTTATTATTACCCTCCCTTCGATAAGATTATTGAAAAGGCAGCTGAGATTGCAAGC
XM_005247532.1      CAACCTTATTATTACCCTCCCTTCGATAAGAG----------------------------
XM_005247530.1      CAACCTTATTATTACCCTCCCTTCGATAAGATTATTGAAAAGGCAGCTGAGATTGCAAGC
NM_006219.2         CAACCTTATTATTACCCTCCCTTCGATAAGATTATTGAAAAGGCAGCTGAGATTGCAAGC
XM_005247531.1      CAACCTTATTATTACCCTCCCTTCGATAAGATTATTGAAAAGGCAGCTGAGATTGCAAGC
                    *******************************                             

HsCD00001636        AGTGATAGTGCTAATGTGTCAAGTCGAGGTGGAAAAAAGTTTCTTCCTGTATTGAAAGAA
XM_005247532.1      -----------------------TCGAGGTGGAAAAAAGTTTCTTCCTGTATTGAAAGAA
XM_005247530.1      AGTGATAGTGCTAATGTGTCAAGTCGAGGTGGAAAAAAGTTTCTTCCTGTATTGAAAGAA
NM_006219.2         AGTGATAGTGCTAATGTGTCAAGTCGAGGTGGAAAAAAGTTTCTTCCTGTATTGAAAGAA
XM_005247531.1      AGTGATAGTGCTAATGTGTCAAGTCGAGGTGGAAAAAAGTTTCTTCCTGTATTGAAAGAA
                                           *************************************

HsCD00001636        ATCTTGGACAGGGATCCCTTGTCTCAACTGTGTGAAAATGAAATGGATCTTATTTGGACT
XM_005247532.1      ATCTTGGACAGGGATCCCTTGTCTCAACTGTGTGAAAATGAAATGGATCTTATTTGGACT
XM_005247530.1      ATCTTGGACAGGGATCCCTTGTCTCAACTGTGTGAAAATGAAATGGATCTTATTTGGACT
NM_006219.2         ATCTTGGACAGGGATCCCTTGTCTCAACTGTGTGAAAATGAAATGGATCTTATTTGGACT
XM_005247531.1      ATCTTGGACAGGGATCCCTTGTCTCAACTGTGTGAAAATGAAATGGATCTTATTTGGACT
                    ************************************************************

HsCD00001636        TTGCGACAAGACTGCCGAGAGATTTTCCCACAATCACTGCCAAAATTACTGCTGTCAATC
XM_005247532.1      TTGCGACAAGACTGCCGAGAGATTTTCCCACAATCACTGCCAAAATTACTGCTGTCAATC
XM_005247530.1      TTGCGACAAGACTGCCGAGAGATTTTCCCACAATCACTGCCAAAATTACTGCTGTCAATC
NM_006219.2         TTGCGACAAGACTGCCGAGAGATTTTCCCACAATCACTGCCAAAATTACTGCTGTCAATC
XM_005247531.1      TTGCGACAAGACTGCCGAGAGATTTTCCCACAATCACTGCCAAAATTACTGCTGTCAATC
                    ************************************************************

HsCD00001636        AAGTGGAATAAACTTGAGGATGTTGCTCAGCTTCAGGCGCTGCTTCAGATTTGGCCTAAA
XM_005247532.1      AAGTGGAATAAACTTGAGGATGTTGCTCAGCTTCAGGCGCTGCTTCAGATTTGGCCTAAA
XM_005247530.1      AAGTGGAATAAACTTGAGGATGTTGCTCAGCTTCAGGCGCTGCTTCAGATTTGGCCTAAA
NM_006219.2         AAGTGGAATAAACTTGAGGATGTTGCTCAGCTTCAGGCGCTGCTTCAGATTTGGCCTAAA
XM_005247531.1      AAGTGGAATAAACTTGAGGATGTTGCTCAGCTTCAGGCGCTGCTTCAGATTTGGCCTAAA
                    ************************************************************

HsCD00001636        CTGCCCCCCCGGGAGGCCCTAGAGCTTCTGGATTTCAACTATCCAGACCAGTACGTTCGA
XM_005247532.1      CTGCCCCCCCGGGAGGCCCTAGAGCTTCTGGATTTCAACTATCCAGACCAGTACGTTCGA
XM_005247530.1      CTGCCCCCCCGGGAGGCCCTAGAGCTTCTGGATTTCAACTATCCAGACCAGTACGTTCGA
NM_006219.2         CTGCCCCCCCGGGAGGCCCTAGAGCTTCTGGATTTCAACTATCCAGACCAGTACGTTCGA
XM_005247531.1      CTGCCCCCCCGGGAGGCCCTAGAGCTTCTGGATTTCAACTATCCAGACCAGTACGTTCGA
                    ************************************************************

HsCD00001636        GAATATGCTGTAGGCTGCCTGCGACAGATGAGTGATGAAGAACTTTCTCAATATCTTTTA
XM_005247532.1      GAATATGCTGTAGGCTGCCTGCGACAGATGAGTGATGAAGAACTTTCTCAATATCTTTTA
XM_005247530.1      GAATATGCTGTAGGCTGCCTGCGACAGATGAGTGATGAAGAACTTTCTCAATATCTTTTA
NM_006219.2         GAATATGCTGTAGGCTGCCTGCGACAGATGAGTGATGAAGAACTTTCTCAATATCTTTTA
XM_005247531.1      GAATATGCTGTAGGCTGCCTGCGACAGATGAGTGATGAAGAACTTTCTCAATATCTTTTA
                    ************************************************************

HsCD00001636        CAACTGGTGCAAGTGTTAAAATATGAGCCTTTTCTTGATTGTGCCCTCTCTAGATTCCTA
XM_005247532.1      CAACTGGTGCAAGTGTTAAAATATGAGCCTTTTCTTGATTGTGCCCTCTCTAGATTCCTA
XM_005247530.1      CAACTGGTGCAAGTGTTAAAATATGAGCCTTTTCTTGATTGTGCCCTCTCTAGATTCCTA
NM_006219.2         CAACTGGTGCAAGTGTTAAAATATGAGCCTTTTCTTGATTGTGCCCTCTCTAGATTCCTA
XM_005247531.1      CAACTGGTGCAAGTGTTAAAATATGAGCCTTTTCTTGATTGTGCCCTCTCTAGATTCCTA
                    ************************************************************

HsCD00001636        TTAGAAAGAGCACTTGGTAATCGGAGGATAGGGCAGTTTCTATTTTGGCATCTTAGGTCA
XM_005247532.1      TTAGAAAGAGCACTTGGTAATCGGAGGATAGGGCAGTTTCTATTTTGGCATCTTAGGTCA
XM_005247530.1      TTAGAAAGAGCACTTGGTAATCGGAGGATAGGGCAGTTTCTATTTTGGCATCTTAGGTCA
NM_006219.2         TTAGAAAGAGCACTTGGTAATCGGAGGATAGGGCAGTTTCTATTTTGGCATCTTAGGTCA
XM_005247531.1      TTAGAAAGAGCACTTGGTAATCGGAGGATAGGGCAGTTTCTATTTTGGCATCTTAGGTCA
                    ************************************************************

HsCD00001636        GAAGTGCACATTCCTGCTGTCTCAGTACAATTTGGTGTCATCCTTGAAGCATACTGCCGG
XM_005247532.1      GAAGTGCACATTCCTGCTGTCTCAGTACAATTTGGTGTCATCCTTGAAGCATACTGCCGG
XM_005247530.1      GAAGTGCACATTCCTGCTGTCTCAGTACAATTTGGTGTCATCCTTGAAGCATACTGCCGG
NM_006219.2         GAAGTGCACATTCCTGCTGTCTCAGTACAATTTGGTGTCATCCTTGAAGCATACTGCCGG
XM_005247531.1      GAAGTGCACATTCCTGCTGTCTCAGTACAATTTGGTGTCATCCTTGAAGCATACTGCCGG
                    ************************************************************

HsCD00001636        GGAAGTGTGGGGCACATGAAAGTGCTTTCTAAGCAGGTTGAAGCACTCAATAAGTTAAAA
XM_005247532.1      GGAAGTGTGGGGCACATGAAAGTGCTTTCTAAGCAGGTTGAAGCACTCAATAAGTTAAAA
XM_005247530.1      GGAAGTGTGGGGCACATGAAAGTGCTTTCTAAGCAGGTTGAAGCACTCAATAAGTTAAAA
NM_006219.2         GGAAGTGTGGGGCACATGAAAGTGCTTTCTAAGCAGGTTGAAGCACTCAATAAGTTAAAA
XM_005247531.1      GGAAGTGTGGGGCACATGAAAGTGCTTTCTAAGCAGGTTGAAGCACTCAATAAGTTAAAA
                    ************************************************************

HsCD00001636        ACTTTAAATAGTTTAATCAAACTGAATGCCGTGAAGTTAAACAGAGCCAAAGGGAAGGAG
XM_005247532.1      ACTTTAAATAGTTTAATCAAACTGAATGCCGTGAAGTTAAACAGAGCCAAAGGGAAGGAG
XM_005247530.1      ACTTTAAATAGTTTAATCAAACTGAATGCCGTGAAGTTAAACAGAGCCAAAGGGAAGGAG
NM_006219.2         ACTTTAAATAGTTTAATCAAACTGAATGCCGTGAAGTTAAACAGAGCCAAAGGGAAGGAG
XM_005247531.1      ACTTTAAATAGTTTAATCAAACTGAATGCCGTGAAGTTAAACAGAGCCAAAGGGAAGGAG
                    ************************************************************

HsCD00001636        GCCATGCATACCTGTTTAAAACAGAGTGCTTACCGGGAAGCCCTCTCTGACCTGCAGTCA
XM_005247532.1      GCCATGCATACCTGTTTAAAACAGAGTGCTTACCGGGAAGCCCTCTCTGACCTGCAGTCA
XM_005247530.1      GCCATGCATACCTGTTTAAAACAGAGTGCTTACCGGGAAGCCCTCTCTGACCTGCAGTCA
NM_006219.2         GCCATGCATACCTGTTTAAAACAGAGTGCTTACCGGGAAGCCCTCTCTGACCTGCAGTCA
XM_005247531.1      GCCATGCATACCTGTTTAAAACAGAGTGCTTACCGGGAAGCCCTCTCTGACCTGCAGTCA
                    ************************************************************

HsCD00001636        CCCCTGAACCCATGTGTTATCCTCTCAGAACTCTATGTTGAAAAGTGCAAATACATGGAT
XM_005247532.1      CCCCTGAACCCATGTGTTATCCTCTCAGAACTCTATGTTGAAAAGTGCAAATACATGGAT
XM_005247530.1      CCCCTGAACCCATGTGTTATCCTCTCAGAACTCTATGTTGAAAAGTGCAAATACATGGAT
NM_006219.2         CCCCTGAACCCATGTGTTATCCTCTCAGAACTCTATGTTGAAAAGTGCAAATACATGGAT
XM_005247531.1      CCCCTGAACCCATGTGTTATCCTCTCAGAACTCTATGTTGAAAAGTGCAAATACATGGAT
                    ************************************************************

HsCD00001636        TCCAAAATGAAGCCTTTGTGGCTGGTATACAATAACAAGGTATTTGGTGAGGATTCAGTT
XM_005247532.1      TCCAAAATGAAGCCTTTGTGGCTGGTATACAATAACAAGGTATTTGGTGAGGATTCAGTT
XM_005247530.1      TCCAAAATGAAGCCTTTGTGGCTGGTATACAATAACAAGGTATTTGGTGAGGATTCAGTT
NM_006219.2         TCCAAAATGAAGCCTTTGTGGCTGGTATACAATAACAAGGTATTTGGTGAGGATTCAGTT
XM_005247531.1      TCCAAAATGAAGCCTTTGTGGCTGGTATACAATAACAAGGTATTTGGTGAGGATTCAGTT
                    ************************************************************

HsCD00001636        GGAGTGATTTTTAAAAATGGTGATGATTTACGACAGGATATGTTGACACTCCAAATGTTG
XM_005247532.1      GGAGTGATTTTTAAAAATGGTGATGATTTACGACAGGATATGTTGACACTCCAAATGTTG
XM_005247530.1      GGAGTGATTTTTAAAAATGGTGATGATTTACGACAGGATATGTTGACACTCCAAATGTTG
NM_006219.2         GGAGTGATTTTTAAAAATGGTGATGATTTACGACAGGATATGTTGACACTCCAAATGTTG
XM_005247531.1      GGAGTGATTTTTAAAAATGGTGATGATTTACGACAGGATATGTTGACACTCCAAATGTTG
                    ************************************************************

HsCD00001636        CGCTTGATGGATTTACTCTGGAAAGAAGCTGGTTTGGATCTTCGGATGTTGCCTTATGGC
XM_005247532.1      CGCTTGATGGATTTACTCTGGAAAGAAGCTGGTTTGGATCTTCGGATGTTGCCTTATGGC
XM_005247530.1      CGCTTGATGGATTTACTCTGGAAAGAAGCTGGTTTGGATCTTCGGATGTTGCCTTATGGC
NM_006219.2         CGCTTGATGGATTTACTCTGGAAAGAAGCTGGTTTGGATCTTCGGATGTTGCCTTATGGC
XM_005247531.1      CGCTTGATGGATTTACTCTGGAAAGAAGCTGGTTTGGATCTTCGGATGTTGCCTTATGGC
                    ************************************************************

HsCD00001636        TGTTTAGCAACAGGAGATCGCTCTGGCCTCATTGAAGTTGTGAGCACCTCTGAAACAATT
XM_005247532.1      TGTTTAGCAACAGGAGATCGCTCTGGCCTCATTGAAGTTGTGAGCACCTCTGAAACAATT
XM_005247530.1      TGTTTAGCAACAGGAGATCGCTCTGGCCTCATTGAAGTTGTGAGCACCTCTGAAACAATT
NM_006219.2         TGTTTAGCAACAGGAGATCGCTCTGGCCTCATTGAAGTTGTGAGCACCTCTGAAACAATT
XM_005247531.1      TGTTTAGCAACAGGAGATCGCTCTGGCCTCATTGAAGTTGTGAGCACCTCTGAAACAATT
                    ************************************************************

HsCD00001636        GCTGACATTCAGCTGAACAGTAGCAATGTGGCTGCTGCAGCAGCCTTCAACAAAGATGCC
XM_005247532.1      GCTGACATTCAGCTGAACAGTAGCAATGTGGCTGCTGCAGCAGCCTTCAACAAAGATGCC
XM_005247530.1      GCTGACATTCAGCTGAACAGTAGCAATGTGGCTGCTGCAGCAGCCTTCAACAAAGATGCC
NM_006219.2         GCTGACATTCAGCTGAACAGTAGCAATGTGGCTGCTGCAGCAGCCTTCAACAAAGATGCC
XM_005247531.1      GCTGACATTCAGCTGAACAGTAGCAATGTGGCTGCTGCAGCAGCCTTCAACAAAGATGCC
                    ************************************************************

HsCD00001636        CTTCTGAACTGGCTTAAAGAATACAACTCTGGGGATGACCTGGACCGAGCCATTGAGGAA
XM_005247532.1      CTTCTGAACTGGCTTAAAGAATACAACTCTGGGGATGACCTGGACCGAGCCATTGAGGAA
XM_005247530.1      CTTCTGAACTGGCTTAAAGAATACAACTCTGGGGATGACCTGGACCGAGCCATTGAGGAA
NM_006219.2         CTTCTGAACTGGCTTAAAGAATACAACTCTGGGGATGACCTGGACCGAGCCATTGAGGAA
XM_005247531.1      CTTCTGAACTGGCTTAAAGAATACAACTCTGGGGATGACCTGGACCGAGCCATTGAGGAA
                    ************************************************************

HsCD00001636        TTTACACTGTCCTGTGCTGGCTACTGTGTAGCTTCTTATGTCCTTGGGATTGGTGACAGA
XM_005247532.1      TTTACACTGTCCTGTGCTGGCTACTGTGTAGCTTCTTATGTCCTTGGGATTGGTGACAGA
XM_005247530.1      TTTACACTGTCCTGTGCTGGCTACTGTGTAGCTTCTTATGTCCTTGGGATTGGTGACAGA
NM_006219.2         TTTACACTGTCCTGTGCTGGCTACTGTGTAGCTTCTTATGTCCTTGGGATTGGTGACAGA
XM_005247531.1      TTTACACTGTCCTGTGCTGGCTACTGTGTAGCTTCTTATGTCCTTGGGATTGGTGACAGA
                    ************************************************************

HsCD00001636        CATAGTGACAACATCATGGTCAAAAAAACTGGCCAGCTCTTCCACATTGACTTTGGACAT
XM_005247532.1      CATAGTGACAACATCATGGTCAAAAAAACTGGCCAGCTCTTCCACATTGACTTTGGACAT
XM_005247530.1      CATAGTGACAACATCATGGTCAAAAAAACTGGCCAGCTCTTCCACATTGACTTTGGACAT
NM_006219.2         CATAGTGACAACATCATGGTCAAAAAAACTGGCCAGCTCTTCCACATTGACTTTGGACAT
XM_005247531.1      CATAGTGACAACATCATGGTCAAAAAAACTGGCCAGCTCTTCCACATTGACTTTGGACAT
                    ************************************************************

HsCD00001636        ATTCTTGGAAATTTCAAATCTAAGTTTGGCATTAAAAGGGAGCGAGTGCCTTTTATTCTT
XM_005247532.1      ATTCTTGGAAATTTCAAATCTAAGTTTGGCATTAAAAGGGAGCGAGTGCCTTTTATTCTT
XM_005247530.1      ATTCTTGGAAATTTCAAATCTAAGTTTGGCATTAAAAGGGAGCGAGTGCCTTTTATTCTT
NM_006219.2         ATTCTTGGAAATTTCAAATCTAAGTTTGGCATTAAAAGGGAGCGAGTGCCTTTTATTCTT
XM_005247531.1      ATTCTTGGAAATTTCAAATCTAAGTTTGGCATTAAAAGGGAGCGAGTGCCTTTTATTCTT
                    ************************************************************

HsCD00001636        ACCTATGATTTCATCCATGTCATTCAACAAGGAAAAACAGGAAATACAGAAAAGTTTGGC
XM_005247532.1      ACCTATGATTTCATCCATGTCATTCAACAAGGAAAAACAGGAAATACAGAAAAGTTTGGC
XM_005247530.1      ACCTATGATTTCATCCATGTCATTCAACAAGGAAAAACAGGAAATACAGAAAAGTTTGGC
NM_006219.2         ACCTATGATTTCATCCATGTCATTCAACAAGGAAAAACAGGAAATACAGAAAAGTTTGGC
XM_005247531.1      ACCTATGATTTCATCCATGTCATTCAACAAGGAAAAACAGGAAATACAGAAAAGTTTGGC
                    ************************************************************

HsCD00001636        CGGTTCCGCCAGTGTTGTGAGGATGCATATCTGATTTTACGACGGCATGGGAATCTCTTC
XM_005247532.1      CGGTTCCGCCAGTGTTGTGAGGATGCATATCTGATTTTACGACGGCATGGGAATCTCTTC
XM_005247530.1      CGGTTCCGCCAGTGTTGTGAGGATGCATATCTGATTTTACGACGGCATGGGAATCTCTTC
NM_006219.2         CGGTTCCGCCAGTGTTGTGAGGATGCATATCTGATTTTACGACGGCATGGGAATCTCTTC
XM_005247531.1      CGGTTCCGCCAGTGTTGTGAGGATGCATATCTGATTTTACGACGGCATGGGAATCTCTTC
                    ************************************************************

HsCD00001636        ATCACTCTCTTTGCGCTGATGTTGACTGCAGGGCTTCCTGAACTCACATCAGTCAAAGAT
XM_005247532.1      ATCACTCTCTTTGCGCTGATGTTGACTGCAGGGCTTCCTGAACTCACATCAGTCAAAGAT
XM_005247530.1      ATCACTCTCTTTGCGCTGATGTTGACTGCAGGGCTTCCTGAACTCACATCAGTCAAAGAT
NM_006219.2         ATCACTCTCTTTGCGCTGATGTTGACTGCAGGGCTTCCTGAACTCACATCAGTCAAAGAT
XM_005247531.1      ATCACTCTCTTTGCGCTGATGTTGACTGCAGGGCTTCCTGAACTCACATCAGTCAAAGAT
                    ************************************************************

HsCD00001636        ATACAGTATCTTAAGGACTCTCTTGCATTAGGGAAGAGTGAAGAAGAAGCACTCAAACAG
XM_005247532.1      ATACAGTATCTTAAGGACTCTCTTGCATTAGGGAAGAGTGAAGAAGAAGCACTCAAACAG
XM_005247530.1      ATACAGTATCTTAAGGACTCTCTTGCATTAGGGAAGAGTGAAGAAGAAGCACTCAAACAG
NM_006219.2         ATACAGTATCTTAAGGACTCTCTTGCATTAGGGAAGAGTGAAGAAGAAGCACTCAAACAG
XM_005247531.1      ATACAGTATCTTAAGGACTCTCTTGCATTAGGGAAGAGTGAAGAAGAAGCACTCAAACAG
                    ************************************************************

HsCD00001636        TTTAAGCAAAAATTTGATGAGGCGCTCAGGGAAAGCTGGACTACTAAAGTGAACTGGATG
XM_005247532.1      TTTAAGCAAAAATTTGATGAGGCGCTCAGGGAAAGCTGGACTACTAAAGTGAACTGGATG
XM_005247530.1      TTTAAGCAAAAATTTGATGAGGCGCTCAGGGAAAGCTGGACTACTAAAGTGAACTGGATG
NM_006219.2         TTTAAGCAAAAATTTGATGAGGCGCTCAGGGAAAGCTGGACTACTAAAGTGAACTGGATG
XM_005247531.1      TTTAAGCAAAAATTTGATGAGGCGCTCAGGGAAAGCTGGACTACTAAAGTGAACTGGATG
                    ************************************************************

HsCD00001636        GCCCACACAGTTCGGAAAGACTACAGATCTTTG
XM_005247532.1      GCCCACACAGTTCGGAAAGACTACAGATCTTAA
XM_005247530.1      GCCCACACAGTTCGGAAAGACTACAGATCTTAA
NM_006219.2         GCCCACACAGTTCGGAAAGACTACAGATCTTAA
XM_005247531.1      GCCCACACAGTTCGGAAAGACTACAGATCTTAA
                    *******************************:.

Pathways

NCI : CXCR3-mediated signaling events
NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : EGF receptor (ErbB1) signaling pathway
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : ErbB4 signaling events
NCI : FAS (CD95) signaling pathway
NCI : Internalization of ErbB1
NCI : LPA receptor mediated events
NCI : Nephrin/Neph1 signaling in the kidney podocyte
NCI : PDGFR-beta signaling pathway
NCI : Signaling events mediated by TCPTP
NCI : TRAIL signaling pathway
Panther : Angiogenesis
Panther : Apoptosis signaling pathway
Panther : Axon guidance mediated by netrin
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Hypoxia response via HIF activation
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : Integrin signalling pathway
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
Panther : PI3 kinase pathway
Panther : Ras Pathway
Panther : T cell activation
Panther : VEGF signaling pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : Adaptive Immune System
Reactome : Cell surface interactions at the vascular wall
Reactome : Cell-Cell communication
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream TCR signaling
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : GAB1 signalosome
Reactome : GPVI-mediated activation cascade
Reactome : Hemostasis
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Interleukin receptor SHC signaling
Reactome : Interleukin-2 signaling
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Nephrin interactions
Reactome : PI Metabolism
Reactome : PI-3K cascade
Reactome : PI3K Cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Phospholipid metabolism
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of signaling by CBL
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Role of phospholipids in phagocytosis
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Interleukins
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : Synthesis of PIPs at the plasma membrane
Reactome : TCR signaling
Reactome : Tie2 Signaling
WikiPathway : AMPK signaling
WikiPathway : Focal Adhesion
WikiPathway : G13 Signaling Pathway
WikiPathway : Insulin Signaling
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Toll-like receptor signaling pathway

Clone

Cloning Information : 259
HIP Master Clone ID : 87305
Original Clone ID : FLH000259.01L

Organism


TAX_ID : 9606
Species Specific ID: 5291

Genome

Chromosome : 3
Map Location : 3q22.3

Reagents

Labome : PIK3CB-antibody