DNASU Plasmid Repository • 480.965.5697 | Email

CCNH (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CCNH
Gene Name:  cyclin H
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH055977.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00000167

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 972nts         Open reading frame : 1 to 972
Reference Sequence Alignment

ATGTACCACAACAGTAGTCAGAAGCGGCACTGGACCTTCTCCAGCGAGGAGCAGCTGGCA
AGACTGCGGGCTGACGCCAACCGCAAATTCAGATGCAAAGCCGTGGCCAACGGGAAGGTT
CTTCCGAATGATCCAGTCTTTCTTGAGCCTCATGAAGAAATGACACTCTGCAAATACTAT
GAGAAAAGGTTATTGGAATTCTGTTCGGTGTTTAAGCCAGCAATGCCAAGATCTGTTGTG
GGTACGGCTTGTATGTATTTCAAACGTTTTTATCTTAATAACTCAGTAATGGAATATCAC
CCCAGGATAATAATGCTCACTTGTGCATTTTTGGCCTGCAAAGTAGATGAATTCAATGTA
TCTAGTCCTCAGTTTGTTGGAAACCTCCGGGAGAGTCCTCTTGGACAGGAGAAGGCACTT
GAACAGATACTGGAATATGAACTACTTCTTATACAGCAACTTAATTTCCACCTTATTGTC
CACAATCCCTACAGACCATTTGAGGGCTTCCTCATCGACTTAAAGACCCGCTATCCCATA
TTGGAGAATCCAGAGATTTTGAGGAAAACAGCTGATGACTTTCTTAATAGAATTGCATTG
ACGGATGCTTACCTTTTATACACACCTTCCCAAATTGCCCTGACTGCCATTTTATCTAGT
GCCTCCAGGGCTGGAATTACTATGGAAAGTTATTTATCAGAGAGTCTGATGCTGAAAGAG
AACAGAACTTGCCTGTCACAGTTACTAGATATAATGAAAAGCATGAGAAACTTAGTAAAG
AAGTATGAACCACCCAGATCTGAAGAAGTTGCTGTTCTGAAACAGAAGTTGGAGCGATGT
CATTCTGCTGAGCTTGCACTTAACGTAATCACGAAGAAGAGGAAAGGCTATGAAGATGAT
GATTACGTCTCAAAGAAATCCAAACATGAGGAGGAAGAATGGACTGATGACGACCTGGTA
GAATCTCTCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1032
Start on reference sequence 61
Mutations:
None
Discrepancy:
t489c
                                

5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CCNH
Symbol Nomenclature : CCNH
SYNONYM : CAK; p34; p37
Designation : CAK complex subunit|CDK-activating kinase complex subunit|MO15-associated protein|cyclin-H|cyclin-dependent kinase-activating kinase complex subunit
Full Nomenclature : cyclin H
GENEID : 902
GI : 60813220
GenBank Accession : AY893215
HGNC : 1594
MIM : 601953
Vega : OTTHUMG00000119077
Target GenBank: NM_001239

 

Reference Sequence Alignment

  

HsCD00000167        ATGTACCACAACAGTAGTCAGAAGCGGCACTGGACCTTCTCCAGCGAGGAGCAGCTGGCA
NM_001239.3         ATGTACCACAACAGTAGTCAGAAGCGGCACTGGACCTTCTCCAGCGAGGAGCAGCTGGCA
XM_005248627.1      ATGTACCACAACAGTAGTCAGAAGCGGCACTGGACCTTCTCCAGCGAGGAGCAGCTGGCA
                    ************************************************************

HsCD00000167        AGACTGCGGGCTGACGCCAACCGCAAATTCAGATGCAAAGCCGTGGCCAACGGGAAGGTT
NM_001239.3         AGACTGCGGGCTGACGCCAACCGCAAATTCAGATGCAAAGCCGTGGCCAACGGGAAGGTT
XM_005248627.1      AGACTGCGGGCTGACGCCAACCGCAAATTCAGATGCAAAGCCGTGGCCAACGGGAAGGTT
                    ************************************************************

HsCD00000167        CTTCCGAATGATCCAGTCTTTCTTGAGCCTCATGAAGAAATGACACTCTGCAAATACTAT
NM_001239.3         CTTCCGAATGATCCAGTCTTTCTTGAGCCTCATGAAGAAATGACACTCTGCAAATACTAT
XM_005248627.1      CTTCCGAATGATCCAGTCTTTCTTGAGCCTCATGAAGAAATGACACTCTGCAAATACTAT
                    ************************************************************

HsCD00000167        GAGAAAAGGTTATTGGAATTCTGTTCGGTGTTTAAGCCAGCAATGCCAAGATCTGTTGTG
NM_001239.3         GAGAAAAGGTTATTGGAATTCTGTTCGGTGTTTAAGCCAGCAATGCCAAGATCTGTTGTG
XM_005248627.1      GAGAAAAGGTTATTGGAATTCTGTTCGGTGTTTAAGCCAGCAATGCCAAGATCTGTTGTG
                    ************************************************************

HsCD00000167        GGTACGGCTTGTATGTATTTCAAACGTTTTTATCTTAATAACTCAGTAATGGAATATCAC
NM_001239.3         GGTACGGCTTGTATGTATTTCAAACGTTTTTATCTTAATAACTCAGTAATGGAATATCAC
XM_005248627.1      GGTACGGCTTGTATGTATTTCAAACGTTTTTATCTTAATAACTCAGTAATGGAATATCAC
                    ************************************************************

HsCD00000167        CCCAGGATAATAATGCTCACTTGTGCATTTTTGGCCTGCAAAGTAGATGAATTCAATGTA
NM_001239.3         CCCAGGATAATAATGCTCACTTGTGCATTTTTGGCCTGCAAAGTAGATGAATTCAATGTA
XM_005248627.1      CCCAGGATAATAATGCTCACTTGTGCATTTTTGGCCTGCAAAGTAGATGAATTCAATGTA
                    ************************************************************

HsCD00000167        TCTAGTCCTCAGTTTGTTGGAAACCTCCGGGAGAGTCCTCTTGGACAGGAGAAGGCACTT
NM_001239.3         TCTAGTCCTCAGTTTGTTGGAAACCTCCGGGAGAGTCCTCTTGGACAGGAGAAGGCACTT
XM_005248627.1      TCTAGTCCTCAGTTTGTTGGAAACCTCCGGGAGAGTCCTCTTGGACAGGAGAAGGCACTT
                    ************************************************************

HsCD00000167        GAACAGATACTGGAATATGAACTACTTCTTATACAGCAACTTAATTTCCACCTTATTGTC
NM_001239.3         GAACAGATACTGGAATATGAACTACTTCTTATACAGCAACTTAATTTCCACCTTATTGTC
XM_005248627.1      GAACAGATACTGGAATATGAACTACTTCTTATACAGCAACTTAATTTCCACCTTATTGTC
                    ************************************************************

HsCD00000167        CACAATCCCTACAGACCATTTGAGGGCTTCCTCATCGACTTAAAGACCCGCTATCCCATA
NM_001239.3         CACAATCCTTACAGACCATTTGAGGGCTTCCTCATCGACTTAAAGACCCGCTATCCCATA
XM_005248627.1      CACAATCCTTACAGACCATTTGAGGGCTTCCTCATCGACTTAAAGACCCGCTATCCCATA
                    ******** ***************************************************

HsCD00000167        TTGGAGAATCCAGAGATTTTGAGGAAAACAGCTGATGACTTTCTTAATAGAATTGCATTG
NM_001239.3         TTGGAGAATCCAGAGATTTTGAGGAAAACAGCTGATGACTTTCTTAATAGAATTGCATTG
XM_005248627.1      TTGGAGAATCCAGAGATTTTGAGGAAAACAGCTGATGACTTTCTTAATAGAATTGCATTG
                    ************************************************************

HsCD00000167        ACGGATGCTTACCTTTTATACACACCTTCCCAAATTGCCCTGACTGCCATTTTATCTAGT
NM_001239.3         ACGGATGCTTACCTTTTATACACACCTTCCCAAATTGCCCTGACTGCCATTTTATCTAGT
XM_005248627.1      ACGGATGCTTACCTTTTATACACACCTTCCCAAATTGCCCTGACTGCCATTTTATCTAGT
                    ************************************************************

HsCD00000167        GCCTCCAGGGCTGGAATTACTATGGAAAGTTATTTATCAGAGAGTCTGATGCTGAAAGAG
NM_001239.3         GCCTCCAGGGCTGGAATTACTATGGAAAGTTATTTATCAGAGAGTCTGATGCTGAAAGAG
XM_005248627.1      GCCTCCAGGGCTGGAATTACTATGGAAAGTTATTTATCAGAGAGTCTGATGCTGAAAGAG
                    ************************************************************

HsCD00000167        AACAGAACTTGCCTGTCACAGTTACTAGATATAATGAAAAGCATGAGAAACTTAGTAAAG
NM_001239.3         AACAGAACTTGCCTGTCACAGTTACTAGATATAATGAAAAGCATGAGAAACTTAGTAAAG
XM_005248627.1      AACAGAACTTGCCTGTCACAGTTACTAGATATAATGAAAAGCATGAGAAACTTAGTAAAG
                    ************************************************************

HsCD00000167        AAGTATGAACCACCCAGATCTGAAGAAGTTGCTGTTCTGAAACAGAAGTTGGAGCGATGT
NM_001239.3         AAGTATGAACCACCCAGATCTGAAGAAGTTGCTGTTCTGAAACAGAAGTTGGAGCGATGT
XM_005248627.1      AAGTATGAACCACCCAGATCTGAAGAAGTTGCTGTTCTGAAACAGAAGTTGGAGCGATGT
                    ************************************************************

HsCD00000167        CATTCTGCTGAGCTTGCACTTAACGTAATCACGAAGAAGAGGAAAGGCTATGAAGATGAT
NM_001239.3         CATTCTGCTGAGCTTGCACTTAACGTAATCACGAAGAAGAGGAAAGGCTATGAAGATGAT
XM_005248627.1      CATTCTGCTGAGCTTGCACTTAACGTAATCACGAAGAAGAGGAAAGGCTATGAAGATGAT
                    ************************************************************

HsCD00000167        GATTACGTCTCAAAGAAATCCAAACATGAGGAGGAAGAATGGACTGATGACGACCTGGTA
NM_001239.3         GATTACGTCTCAAAGAAATCCAAACATGAGGAGGAAGAATGGACTGATGACGACCTGGTA
XM_005248627.1      GATTACGTCTCAAAGAAATCCAAACATGAGGAGGTATGTTTTACTCCAAAGATGAACTCT
                    **********************************:* .:*  *** .:.* .: .:   :

HsCD00000167        GAATCTCTCTAG------------------
NM_001239.3         GAATCTCTCTAA------------------
XM_005248627.1      AAGTTATTTTTGTTATACATTCTGGTGTGA
                    .*.* : * *:.                  

Pathways

NCI : Retinoic acid receptors-mediated signaling
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cyclin A/B1 associated events during G2/M transition
Reactome : Cyclin A:Cdk2-associated events at S phase entry
Reactome : Cyclin D associated events in G1
Reactome : Cyclin E associated events during G1/S transition
Reactome : DNA Repair
Reactome : Disease
Reactome : Dual incision reaction in GG-NER
Reactome : Dual incision reaction in TC-NER
Reactome : Epigenetic regulation of gene expression
Reactome : Formation of HIV elongation complex in the absence of HIV Tat
Reactome : Formation of HIV-1 elongation complex containing HIV-1 Tat
Reactome : Formation of RNA Pol II elongation complex
Reactome : Formation of incision complex in GG-NER
Reactome : Formation of the Early Elongation Complex
Reactome : Formation of the HIV-1 Early Elongation Complex
Reactome : Formation of transcription-coupled NER (TC-NER) repair complex
Reactome : G1 Phase
Reactome : G1/S Transition
Reactome : G2/M Transition
Reactome : Gene Expression
Reactome : Global Genomic NER (GG-NER)
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : HIV Transcription Elongation
Reactome : HIV Transcription Initiation
Reactome : Late Phase of HIV Life Cycle
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic G2-G2/M phases
Reactome : Negative epigenetic regulation of rRNA expression
Reactome : NoRC negatively regulates rRNA expression
Reactome : Nucleotide Excision Repair
Reactome : RNA Pol II CTD phosphorylation and interaction with CE
Reactome : RNA Polymerase I Chain Elongation
Reactome : RNA Polymerase I Promoter Clearance
Reactome : RNA Polymerase I Promoter Escape
Reactome : RNA Polymerase I Transcription
Reactome : RNA Polymerase I Transcription Initiation
Reactome : RNA Polymerase I Transcription Termination
Reactome : RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Reactome : RNA Polymerase II HIV Promoter Escape
Reactome : RNA Polymerase II Pre-transcription Events
Reactome : RNA Polymerase II Promoter Escape
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Elongation
Reactome : RNA Polymerase II Transcription Initiation
Reactome : RNA Polymerase II Transcription Initiation And Promoter Clearance
Reactome : RNA Polymerase II Transcription Pre-Initiation And Promoter Opening
Reactome : S Phase
Reactome : Tat-mediated elongation of the HIV-1 transcript
Reactome : Transcription
Reactome : Transcription of the HIV genome
Reactome : Transcription-coupled NER (TC-NER)
Reactome : mRNA Capping
WikiPathway : Cell cycle
WikiPathway : Eukaryotic Transcription Initiation
WikiPathway : G1 to S cell cycle control

Clone

Cloning Information : 55977
HIP Master Clone ID : 33841
Original Clone ID : FLH055977.01X

Organism


TAX_ID : 9606
Species Specific ID: 902

Genome

Chromosome : 5
Map Location : 5q13.3-q14
Ensembl : ENSG00000134480

Reagents

Labome : CCNH-antibody