DNASU Plasmid Repository • 480.965.5697 | Email

SERPINE1 (Homo sapiens) in pDONR201 (Gateway donor/master vector)


Explanation of Terms

Gene: Gene Symbol:  SERPINE1
Gene Name:  serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH057231.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Discrepancy :
No / No
Publications: None
Authors: HIP

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 1209nts         Open reading frame : 1 to 1209
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1331
Start on reference sequence 123
5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : SERPINE1
Symbol Nomenclature : SERPINE1
Designation : endothelial plasminogen activator inhibitor|plasminogen activator inhibitor 1|serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1|serpin E1
Full Nomenclature : serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1
GENEID : 5054
GI : 60829666
GenBank Accession : AY893851
HGNC : 8583
MIM : 173360
Vega : OTTHUMG00000157107
Target GenBank: XM_054850


Reference Sequence Alignment






















HsCD00001677      GAACCCTTG
NM_000602.4       GAACCCTGA
                  ******* .


NCI : Direct p53 effectors
NCI : E2F transcription factor network
NCI : HIF-1-alpha transcription factor network
NCI : HIF-2-alpha transcription factor network
NCI : Regulation of nuclear SMAD2/3 signaling
NCI : Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling
NCI : p73 transcription factor network
Panther : Blood coagulation
Panther : Plasminogen activating cascade
Panther : p53 pathway
Reactome : BMAL1:CLOCK,NPAS2 activates circadian gene expression
Reactome : Circadian Clock
Reactome : Disease
Reactome : Dissolution of Fibrin Clot
Reactome : ECM proteoglycans
Reactome : Extracellular matrix organization
Reactome : Gene Expression
Reactome : Generic Transcription Pathway
Reactome : Hemostasis
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : Platelet activation, signaling and aggregation
Reactome : Platelet degranulation
Reactome : Response to elevated platelet cytosolic Ca2+
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD2/SMAD3:SMAD4 heterotrimer regulates transcription
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : Signal Transduction
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer
Reactome : Transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer
WikiPathway : Adipogenesis
WikiPathway : Blood Clotting Cascade
WikiPathway : Complement and Coagulation Cascades
WikiPathway : Folate Metabolism
WikiPathway : Selenium Pathway
WikiPathway : Senescence and Autophagy
WikiPathway : TGF Beta Signaling Pathway
WikiPathway : Vitamin B12 Metabolism


SMART domain : SERPIN : SERine Proteinase INhibitors
UniProt : B7Z4S0
UniProt : P05121
HPRD : 01418


Cloning Information : 57231
HIP Master Clone ID : 35519
Original Clone ID : FLH057231.01L


TAX_ID : 9606
Species Specific ID: 5054


Chromosome : 7
Map Location : 7q22.1
Ensembl : ENSG00000106366


Labome : PAI-1-antibody