DNASU Plasmid Repository • 480.965.5697 | Email

CCNH (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CCNH
Gene Name:  cyclin H
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH118014.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00000168

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 972nts         Open reading frame : 1 to 972
Reference Sequence Alignment

ATGTACCACAACAGTAGTCAGAAGCGGCACTGGACCTTCTCCAGCGAGGAGCAGCTGGCA
AGACTGCGGGCTGACGCCAACCGCAAATTCAGATGCAAAGCCGTGGCCAACGGGAAGGTT
CTTCCGAATGATCCAGTCTTTCTTGAGCCTCATGAAGAAATGACACTCTGCAAATACTAT
GAGAAAAGGTTATTGGAATTCTGTTCGGTGTTTAAGCCAGCAATGCCAAGATCTGTTGTG
GGTACGGCTTGTATGTATTTCAAACGTTTTTATCTTAATAACTCAGTAATGGAATATCAC
CCCAGGATAATAATGCTCACTTGTGCATTTTTGGCCTGCAAAGTAGATGAATTCAATGTA
TCTAGTCCTCAGTTTGTTGGAAACCTCCGGGAGAGTCCTCTTGGACAGGAGAAGGCACTT
GAACAGATACTGGAATATGAACTACTTCTTATACAGCAACTTAATTTCCACCTTATTGTC
CACAATCCTTACAGACCATTTGAGGGCTTCCTCATCGACTTAAAGACCCGCTATCCCATA
TTGGAGAATCCAGAGATTTTGAGGAAAACAGCTGATGACTTTCTTAATAGAATTGCATTG
ACGGATGCTTACCTTTTATACACACCTTCCCAAATTGCCCTGACTGCCATTTTATCTAGT
GCCTCCAGGGCTGGAATTACTATGGAAAGTTATTTATCAGAGAGTCTGATGCTGAAAGAG
AACAGAACTTGCCTGTCACAGTTACTAGATATAATGAAAAGCATGAGAAACTTAGTAAAG
AAGTATGAACCACCCAGATCTGAAGAAGTTGCTGTTCTGAAACAGAAGTTGGAGCGATGT
CATTCTGCTGAGCTTGCACTTAACGTAATCACGAAGAAGAGGAAAGACTATGAAGATGAT
GATTACGTCTCAAAGAAATCCAAACATGAGGAGGAAGAATGGACTGATGACGACCTGGTA
GAATCTCTCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1032
Start on reference sequence 61
Mutations:
None
Discrepancy:
g887a,G296D
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CCNH
Symbol Nomenclature : CCNH
SYNONYM : CAK; p34; p37
Designation : CAK complex subunit|CDK-activating kinase complex subunit|MO15-associated protein|cyclin-H|cyclin-dependent kinase-activating kinase complex subunit
Full Nomenclature : cyclin H
GENEID : 902
GI : 61365196
GenBank Accession : AY890728
HGNC : 1594
MIM : 601953
Vega : OTTHUMG00000119077
Target GenBank: NM_001239

 

Reference Sequence Alignment

  

HsCD00000168        ATGTACCACAACAGTAGTCAGAAGCGGCACTGGACCTTCTCCAGCGAGGAGCAGCTGGCA
NM_001239.3         ATGTACCACAACAGTAGTCAGAAGCGGCACTGGACCTTCTCCAGCGAGGAGCAGCTGGCA
XM_005248627.1      ATGTACCACAACAGTAGTCAGAAGCGGCACTGGACCTTCTCCAGCGAGGAGCAGCTGGCA
                    ************************************************************

HsCD00000168        AGACTGCGGGCTGACGCCAACCGCAAATTCAGATGCAAAGCCGTGGCCAACGGGAAGGTT
NM_001239.3         AGACTGCGGGCTGACGCCAACCGCAAATTCAGATGCAAAGCCGTGGCCAACGGGAAGGTT
XM_005248627.1      AGACTGCGGGCTGACGCCAACCGCAAATTCAGATGCAAAGCCGTGGCCAACGGGAAGGTT
                    ************************************************************

HsCD00000168        CTTCCGAATGATCCAGTCTTTCTTGAGCCTCATGAAGAAATGACACTCTGCAAATACTAT
NM_001239.3         CTTCCGAATGATCCAGTCTTTCTTGAGCCTCATGAAGAAATGACACTCTGCAAATACTAT
XM_005248627.1      CTTCCGAATGATCCAGTCTTTCTTGAGCCTCATGAAGAAATGACACTCTGCAAATACTAT
                    ************************************************************

HsCD00000168        GAGAAAAGGTTATTGGAATTCTGTTCGGTGTTTAAGCCAGCAATGCCAAGATCTGTTGTG
NM_001239.3         GAGAAAAGGTTATTGGAATTCTGTTCGGTGTTTAAGCCAGCAATGCCAAGATCTGTTGTG
XM_005248627.1      GAGAAAAGGTTATTGGAATTCTGTTCGGTGTTTAAGCCAGCAATGCCAAGATCTGTTGTG
                    ************************************************************

HsCD00000168        GGTACGGCTTGTATGTATTTCAAACGTTTTTATCTTAATAACTCAGTAATGGAATATCAC
NM_001239.3         GGTACGGCTTGTATGTATTTCAAACGTTTTTATCTTAATAACTCAGTAATGGAATATCAC
XM_005248627.1      GGTACGGCTTGTATGTATTTCAAACGTTTTTATCTTAATAACTCAGTAATGGAATATCAC
                    ************************************************************

HsCD00000168        CCCAGGATAATAATGCTCACTTGTGCATTTTTGGCCTGCAAAGTAGATGAATTCAATGTA
NM_001239.3         CCCAGGATAATAATGCTCACTTGTGCATTTTTGGCCTGCAAAGTAGATGAATTCAATGTA
XM_005248627.1      CCCAGGATAATAATGCTCACTTGTGCATTTTTGGCCTGCAAAGTAGATGAATTCAATGTA
                    ************************************************************

HsCD00000168        TCTAGTCCTCAGTTTGTTGGAAACCTCCGGGAGAGTCCTCTTGGACAGGAGAAGGCACTT
NM_001239.3         TCTAGTCCTCAGTTTGTTGGAAACCTCCGGGAGAGTCCTCTTGGACAGGAGAAGGCACTT
XM_005248627.1      TCTAGTCCTCAGTTTGTTGGAAACCTCCGGGAGAGTCCTCTTGGACAGGAGAAGGCACTT
                    ************************************************************

HsCD00000168        GAACAGATACTGGAATATGAACTACTTCTTATACAGCAACTTAATTTCCACCTTATTGTC
NM_001239.3         GAACAGATACTGGAATATGAACTACTTCTTATACAGCAACTTAATTTCCACCTTATTGTC
XM_005248627.1      GAACAGATACTGGAATATGAACTACTTCTTATACAGCAACTTAATTTCCACCTTATTGTC
                    ************************************************************

HsCD00000168        CACAATCCTTACAGACCATTTGAGGGCTTCCTCATCGACTTAAAGACCCGCTATCCCATA
NM_001239.3         CACAATCCTTACAGACCATTTGAGGGCTTCCTCATCGACTTAAAGACCCGCTATCCCATA
XM_005248627.1      CACAATCCTTACAGACCATTTGAGGGCTTCCTCATCGACTTAAAGACCCGCTATCCCATA
                    ************************************************************

HsCD00000168        TTGGAGAATCCAGAGATTTTGAGGAAAACAGCTGATGACTTTCTTAATAGAATTGCATTG
NM_001239.3         TTGGAGAATCCAGAGATTTTGAGGAAAACAGCTGATGACTTTCTTAATAGAATTGCATTG
XM_005248627.1      TTGGAGAATCCAGAGATTTTGAGGAAAACAGCTGATGACTTTCTTAATAGAATTGCATTG
                    ************************************************************

HsCD00000168        ACGGATGCTTACCTTTTATACACACCTTCCCAAATTGCCCTGACTGCCATTTTATCTAGT
NM_001239.3         ACGGATGCTTACCTTTTATACACACCTTCCCAAATTGCCCTGACTGCCATTTTATCTAGT
XM_005248627.1      ACGGATGCTTACCTTTTATACACACCTTCCCAAATTGCCCTGACTGCCATTTTATCTAGT
                    ************************************************************

HsCD00000168        GCCTCCAGGGCTGGAATTACTATGGAAAGTTATTTATCAGAGAGTCTGATGCTGAAAGAG
NM_001239.3         GCCTCCAGGGCTGGAATTACTATGGAAAGTTATTTATCAGAGAGTCTGATGCTGAAAGAG
XM_005248627.1      GCCTCCAGGGCTGGAATTACTATGGAAAGTTATTTATCAGAGAGTCTGATGCTGAAAGAG
                    ************************************************************

HsCD00000168        AACAGAACTTGCCTGTCACAGTTACTAGATATAATGAAAAGCATGAGAAACTTAGTAAAG
NM_001239.3         AACAGAACTTGCCTGTCACAGTTACTAGATATAATGAAAAGCATGAGAAACTTAGTAAAG
XM_005248627.1      AACAGAACTTGCCTGTCACAGTTACTAGATATAATGAAAAGCATGAGAAACTTAGTAAAG
                    ************************************************************

HsCD00000168        AAGTATGAACCACCCAGATCTGAAGAAGTTGCTGTTCTGAAACAGAAGTTGGAGCGATGT
NM_001239.3         AAGTATGAACCACCCAGATCTGAAGAAGTTGCTGTTCTGAAACAGAAGTTGGAGCGATGT
XM_005248627.1      AAGTATGAACCACCCAGATCTGAAGAAGTTGCTGTTCTGAAACAGAAGTTGGAGCGATGT
                    ************************************************************

HsCD00000168        CATTCTGCTGAGCTTGCACTTAACGTAATCACGAAGAAGAGGAAAGACTATGAAGATGAT
NM_001239.3         CATTCTGCTGAGCTTGCACTTAACGTAATCACGAAGAAGAGGAAAGGCTATGAAGATGAT
XM_005248627.1      CATTCTGCTGAGCTTGCACTTAACGTAATCACGAAGAAGAGGAAAGGCTATGAAGATGAT
                    **********************************************.*************

HsCD00000168        GATTACGTCTCAAAGAAATCCAAACATGAGGAGGAAGAATGGACTGATGACGACCTGGTA
NM_001239.3         GATTACGTCTCAAAGAAATCCAAACATGAGGAGGAAGAATGGACTGATGACGACCTGGTA
XM_005248627.1      GATTACGTCTCAAAGAAATCCAAACATGAGGAGGTATGTTTTACTCCAAAGATGAACTCT
                    **********************************:* .:*  *** .:.* .: .:   :

HsCD00000168        GAATCTCTCTTG------------------
NM_001239.3         GAATCTCTCTAA------------------
XM_005248627.1      AAGTTATTTTTGTTATACATTCTGGTGTGA
                    .*.* : * *:.                  

Pathways

NCI : Retinoic acid receptors-mediated signaling
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cyclin A/B1 associated events during G2/M transition
Reactome : Cyclin A:Cdk2-associated events at S phase entry
Reactome : Cyclin D associated events in G1
Reactome : Cyclin E associated events during G1/S transition
Reactome : DNA Repair
Reactome : Disease
Reactome : Dual incision reaction in GG-NER
Reactome : Dual incision reaction in TC-NER
Reactome : Epigenetic regulation of gene expression
Reactome : Formation of HIV elongation complex in the absence of HIV Tat
Reactome : Formation of HIV-1 elongation complex containing HIV-1 Tat
Reactome : Formation of RNA Pol II elongation complex
Reactome : Formation of incision complex in GG-NER
Reactome : Formation of the Early Elongation Complex
Reactome : Formation of the HIV-1 Early Elongation Complex
Reactome : Formation of transcription-coupled NER (TC-NER) repair complex
Reactome : G1 Phase
Reactome : G1/S Transition
Reactome : G2/M Transition
Reactome : Gene Expression
Reactome : Global Genomic NER (GG-NER)
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : HIV Transcription Elongation
Reactome : HIV Transcription Initiation
Reactome : Late Phase of HIV Life Cycle
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic G2-G2/M phases
Reactome : Negative epigenetic regulation of rRNA expression
Reactome : NoRC negatively regulates rRNA expression
Reactome : Nucleotide Excision Repair
Reactome : RNA Pol II CTD phosphorylation and interaction with CE
Reactome : RNA Polymerase I Chain Elongation
Reactome : RNA Polymerase I Promoter Clearance
Reactome : RNA Polymerase I Promoter Escape
Reactome : RNA Polymerase I Transcription
Reactome : RNA Polymerase I Transcription Initiation
Reactome : RNA Polymerase I Transcription Termination
Reactome : RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Reactome : RNA Polymerase II HIV Promoter Escape
Reactome : RNA Polymerase II Pre-transcription Events
Reactome : RNA Polymerase II Promoter Escape
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Elongation
Reactome : RNA Polymerase II Transcription Initiation
Reactome : RNA Polymerase II Transcription Initiation And Promoter Clearance
Reactome : RNA Polymerase II Transcription Pre-Initiation And Promoter Opening
Reactome : S Phase
Reactome : Tat-mediated elongation of the HIV-1 transcript
Reactome : Transcription
Reactome : Transcription of the HIV genome
Reactome : Transcription-coupled NER (TC-NER)
Reactome : mRNA Capping
WikiPathway : Cell cycle
WikiPathway : Eukaryotic Transcription Initiation
WikiPathway : G1 to S cell cycle control

Clone

Cloning Information : 118014
HIP Master Clone ID : 93860
Original Clone ID : FLH118014.01L

Organism


TAX_ID : 9606
Species Specific ID: 902

Genome

Chromosome : 5
Map Location : 5q13.3-q14
Ensembl : ENSG00000134480

Reagents

Labome : CCNH-antibody