DNASU Plasmid Repository • 480.965.5697 | Email

RAD51 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RAD51
Gene Name:  RAD51 recombinase
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH018816.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00001692

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1020nts         Open reading frame : 1 to 1020
Reference Sequence Alignment

ATGGCAATGCAGATGCAGCTTGAAGCAAATGCAGATACTTCAGTGGAAGAAGAAAGCTTT
GGCCCACAACCCATTTCACGGTTAGAGCAGTGTGGCATAAATGCCAACGATGTGAAGAAA
TTGGAAGAAGCTGGATTCCATACTGTGGAGGCTGTTGCCTATGCGCCAAAGAAGGAGCTA
ATAAATATTAAGGGAATTAGTGAAGCCAAAGCTGATAAAATTCTGGCTGAGGCAGCTAAA
TTAGTTCCAATGGGTTTCACCACTGCAACTGAATTCCACCAAAGGCGGTCAGAGATCATA
CAGATTACTACTGGCTCCAAAGAGCTTGACAAACTACTTCAAGGTGGAATTGAGACTGGA
TCTATCACAGAAATGTTTGGAGAATTCCGAACTGGGAAGACCCAGATCTGTCATACGCTA
GCTGTCACCTGCCAGCTTCCCATTGACCGGGGTGGAGGTGAAGGAAAGGCCATGTACATT
GACACTGAGGGTACCTTTAGGCCAGAACGGCTGCTGGCAGTGGCTGAGAGGTATGGTCTC
TCTGGCAGTGATGTCCTGGATAATGTAGCATATGCTCGAGCGTTCAACACAGACCACCAG
ACCCAGCTCCTTTATCAAGCATCAGCCATGATGGTAGAATCTAGGTATGCACTGCTTATT
GTAGACAGTGCCACCGCCCTTTACAGAACAGACTACTCGGGTCGAGGTGAGCTTTCAGCC
AGGCAGATGCACTTGGCCAGGTTTCTGCGGATGCTTCTGCGACTCGCTGATGAGTTTGGT
GTAGCAGTGGTAATCACTAATCAGGTGGTAGCTCAAGTGGATGGAGCAGCGATGTTTGCT
GCTGATCCCAAAAAACCTATTGGAGGAAATATCATCGCCCATGCATCAACAACCAGATTG
TATCTGAGGAAAGGAAGAGGGGAAACCAGAATCTGCAAAATCTACGACTCTCCCTGTCTT
CCTGAAGCTGAAGCTATGTTCGCCATTAATGCAGATGGAGTGGGAGATGCCAAAGACTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1252
Start on reference sequence 233
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RAD51
Symbol Nomenclature : RAD51
SYNONYM : BRCC5; HRAD51; HsRad51; HsT16930; MRMV2; RAD51A; RECA
Designation : BRCA1/BRCA2-containing complex, subunit 5|DNA repair protein RAD51 homolog 1|RAD51 homolog A|RecA, E. coli, homolog of|RecA-like protein|recombination protein A
Full Nomenclature : RAD51 recombinase
GENEID : 5888
GI : 61358912
GenBank Accession : AY888698
HGNC : 9817
MIM : 179617
Vega : OTTHUMG00000130067
Target GenBank: D14134

 

Reference Sequence Alignment

  

HsCD00001692      ATGGCAATGCAGATGCAGCTTGAAGCAAATGCAGATACTTCAGTGGAAGAAGAAAGCTTT
NM_002875.4       ATGGCAATGCAGATGCAGCTTGAAGCAAATGCAGATACTTCAGTGGAAGAAGAAAGCTTT
                  ************************************************************

HsCD00001692      GGCCCACAACCCATTTCACGGTTAGAGCAGTGTGGCATAAATGCCAACGATGTGAAGAAA
NM_002875.4       GGCCCACAACCCATTTCACGGTTAGAGCAGTGTGGCATAAATGCCAACGATGTGAAGAAA
                  ************************************************************

HsCD00001692      TTGGAAGAAGCTGGATTCCATACTGTGGAGGCTGTTGCCTATGCGCCAAAGAAGGAGCTA
NM_002875.4       TTGGAAGAAGCTGGATTCCATACTGTGGAGGCTGTTGCCTATGCGCCAAAGAAGGAGCTA
                  ************************************************************

HsCD00001692      ATAAATATTAAGGGAATTAGTGAAGCCAAAGCTGATAAAATTCTGGCTGAGGCAGCTAAA
NM_002875.4       ATAAATATTAAGGGAATTAGTGAAGCCAAAGCTGATAAAATTCTGGCTGAGGCAGCTAAA
                  ************************************************************

HsCD00001692      TTAGTTCCAATGGGTTTCACCACTGCAACTGAATTCCACCAAAGGCGGTCAGAGATCATA
NM_002875.4       TTAGTTCCAATGGGTTTCACCACTGCAACTGAATTCCACCAAAGGCGGTCAGAGATCATA
                  ************************************************************

HsCD00001692      CAGATTACTACTGGCTCCAAAGAGCTTGACAAACTACTTCAAGGTGGAATTGAGACTGGA
NM_002875.4       CAGATTACTACTGGCTCCAAAGAGCTTGACAAACTACTTCAAGGTGGAATTGAGACTGGA
                  ************************************************************

HsCD00001692      TCTATCACAGAAATGTTTGGAGAATTCCGAACTGGGAAGACCCAGATCTGTCATACGCTA
NM_002875.4       TCTATCACAGAAATGTTTGGAGAATTCCGAACTGGGAAGACCCAGATCTGTCATACGCTA
                  ************************************************************

HsCD00001692      GCTGTCACCTGCCAGCTTCCCATTGACCGGGGTGGAGGTGAAGGAAAGGCCATGTACATT
NM_002875.4       GCTGTCACCTGCCAGCTTCCCATTGACCGGGGTGGAGGTGAAGGAAAGGCCATGTACATT
                  ************************************************************

HsCD00001692      GACACTGAGGGTACCTTTAGGCCAGAACGGCTGCTGGCAGTGGCTGAGAGGTATGGTCTC
NM_002875.4       GACACTGAGGGTACCTTTAGGCCAGAACGGCTGCTGGCAGTGGCTGAGAGGTATGGTCTC
                  ************************************************************

HsCD00001692      TCTGGCAGTGATGTCCTGGATAATGTAGCATATGCTCGAGCGTTCAACACAGACCACCAG
NM_002875.4       TCTGGCAGTGATGTCCTGGATAATGTAGCATATGCTCGAGCGTTCAACACAGACCACCAG
                  ************************************************************

HsCD00001692      ACCCAGCTCCTTTATCAAGCATCAGCCATGATGGTAGAATCTAGGTATGCACTGCTTATT
NM_002875.4       ACCCAGCTCCTTTATCAAGCATCAGCCATGATGGTAGAATCTAGGTATGCACTGCTTATT
                  ************************************************************

HsCD00001692      GTAGACAGTGCCACCGCCCTTTACAGAACAGACTACTCGGGTCGAGGTGAGCTTTCAGCC
NM_002875.4       GTAGACAGTGCCACCGCCCTTTACAGAACAGACTACTCGGGTCGAGGTGAGCTTTCAGCC
                  ************************************************************

HsCD00001692      AGGCAGATGCACTTGGCCAGGTTTCTGCGGATGCTTCTGCGACTCGCTGATGAGTTTGGT
NM_002875.4       AGGCAGATGCACTTGGCCAGGTTTCTGCGGATGCTTCTGCGACTCGCTGATGAGTTTGGT
                  ************************************************************

HsCD00001692      GTAGCAGTGGTAATCACTAATCAGGTGGTAGCTCAAGTGGATGGAGCAGCGATGTTTGCT
NM_002875.4       GTAGCAGTGGTAATCACTAATCAGGTGGTAGCTCAAGTGGATGGAGCAGCGATGTTTGCT
                  ************************************************************

HsCD00001692      GCTGATCCCAAAAAACCTATTGGAGGAAATATCATCGCCCATGCATCAACAACCAGATTG
NM_002875.4       GCTGATCCCAAAAAACCTATTGGAGGAAATATCATCGCCCATGCATCAACAACCAGATTG
                  ************************************************************

HsCD00001692      TATCTGAGGAAAGGAAGAGGGGAAACCAGAATCTGCAAAATCTACGACTCTCCCTGTCTT
NM_002875.4       TATCTGAGGAAAGGAAGAGGGGAAACCAGAATCTGCAAAATCTACGACTCTCCCTGTCTT
                  ************************************************************

HsCD00001692      CCTGAAGCTGAAGCTATGTTCGCCATTAATGCAGATGGAGTGGGAGATGCCAAAGACTGA
NM_002875.4       CCTGAAGCTGAAGCTATGTTCGCCATTAATGCAGATGGAGTGGGAGATGCCAAAGACTGA
                  ************************************************************

Pathways

NCI : ATR signaling pathway
NCI : BARD1 signaling events
NCI : p73 transcription factor network
Reactome : Assembly of the RAD51-ssDNA nucleoprotein complex
Reactome : Cell Cycle
Reactome : DNA Repair
Reactome : Double-Strand Break Repair
Reactome : Homologous DNA pairing and strand exchange
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Presynaptic phase of homologous DNA pairing and strand exchange
WikiPathway : DNA damage response
WikiPathway : Homologous recombination
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : miRNA regulation of DNA Damage Response

Protein

SMART domain : AAA : ATPases associated with a variety of cellular activities
UniProt : Q6ZNA8
UniProt : B0FXP0
UniProt : Q06609
HPRD : 01557

Clone

Cloning Information : 18816
HIP Master Clone ID : 33015
Original Clone ID : FLH018816.01X

Organism


TAX_ID : 9606
Species Specific ID: 5888

Genome

Chromosome : 15
Map Location : 15q15.1
Ensembl : ENSG00000051180

Reagents

Labome : RAD51-antibody