DNASU Plasmid Repository • 480.965.5697 | Email

CHEK1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CHEK1
Gene Name:  checkpoint kinase 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH117918.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00000170

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1431nts         Open reading frame : 1 to 1431
Reference Sequence Alignment

ATGGCAGTGCCCTTTGTGGAAGACTGGGACTTGGTGCAAACCCTGGGAGAAGGTGCCTAT
GGAGAAGTTCAACTTGCTGTGAATAGAGTAACTGAAGAAGCAGTCGCAGTGAAGATTGTA
GATATGAAGCGTGCCGTAGACTGTCCAGAAAATATTAAGAAAGAGATCTGTATCAATAAA
ATGCTAAATCATGAAAATGTAGTAAAATTCTATGGTCACAGGAGAGAAGGCAATATCCAA
TATTTATTTCTGGAGTACTGTAGTGGAGGAGAGCTTTTTGACAGAATAGAGCCAGACATA
GGCATGCCTGAACCAGATGCTCAGAGATTCTTCCATCAACTCATGGCAGGGGTGGTTTAT
CTGCATGGTATTGGAATAACTCACAGGGATATTAAACCAGAAAATCTTCTGTTGGATGAA
AGGGATAACCTCAAAATCTCAGACTTTGGCTTGGCAACAGTATTTCGGTATAATAATCGT
GAGCGTTTGTTGAACAAGATGTGTGGTACTTTACCATATGTTGCTCCAGAACTTCTGAAG
AGAAGAGAATTTCATGCAGAACCAGTTGATGTTTGGTCCTGTGGAATAGTACTTACTGCA
ATGCTCGCTGGAGAATTGCCATGGGACCAACCCAGTGACAGCTGTCAGGAGTATTCTGAC
TGGAAAGAAAAAAAAACATACCTCAACCCTTGGAAAAAAATCGATTCTGCTCCTCTAGCT
CTGCTGCATAAAATCTTAGTTGAGAATCCATCAGCAAGAATTACCATTCCAGACATCAAA
AAAGATAGATGGTACAACAAACCCCTCAAGAAAGGGGCAAAAAGGCCCCGAGTCACTTCA
GGTGGTGTGTCAGAGTCTCCCAGTGGATTTTCTAAGCACATTCAATCCAATTTGGACTTC
TCTCCAGTAAACAGTGCTTCTAGTGAAGAAAATGTGAAGTACTCCAGTTCTCAGCCAGAA
CCCCGCACAGGTCTTTCCTTATGGGATACCAGCCCCTCATACATTGATAAATTGGTACAA
GGGATCAGCTTTTCCCAGCCCACATGTCCTGATCATATGCTTTTGAATAGTCAGTTACTT
GGCACCCCAGGATCCTCACAGAACCCCTGGCAGCGGTTGGTCAAAAGAATGACACGATTC
TTTACCAAATTGGATGCAGACAAATCTTATCAATGCCTGAAAGAGACTTGTGAGAAGTTG
GGCTATCAATGGAAGAAAAGTTGTATGAATCAGGTTACTATATCAACAACTGATAGGAGA
AACAATAAACTCATTTTCAAAGTGAATTTGTTAGAAATGGATGATAAAATATTGGTTGAC
TTCCGGCTTTCTAAGGGTGATGGATTGGAGTTCAAGAGACACTTCCTGAAGATTAAAGGG
AAGCTGATTGATATTGTGAGCAGCCAGAAGGTTTGGCTTCCTGCCACATGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1465
Start on reference sequence 35
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CHEK1
Symbol Nomenclature : CHEK1
SYNONYM : CHK1
Designation : CHK1 checkpoint homolog|Checkpoint, S. pombe, homolog of, 1|Chk1-S|cell cycle checkpoint kinase|checkpoint kinase-1|serine/threonine-protein kinase Chk1
Full Nomenclature : checkpoint kinase 1
GENEID : 1111
GI : 61355061
GenBank Accession : AY888148
HGNC : 1925
MIM : 603078
Vega : OTTHUMG00000165853
Target GenBank: NM_001274

 

Reference Sequence Alignment

  

HsCD00000170        ATGGCAGTGCCCTTTGTGGAAGACTGGGACTTGGTGCAAACCCTGGGAGAAGGTGCCTAT
NM_001114121.2      ATGGCAGTGCCCTTTGTGGAAGACTGGGACTTGGTGCAAACCCTGGGAGAAGGTGCCTAT
NM_001244846.1      ATGGCAGTGCCCTTTGTGGAAGACTGGGACTTGGTGCAAACCCTGGGAGAAGGTGCCTAT
NM_001114122.2      ATGGCAGTGCCCTTTGTGGAAGACTGGGACTTGGTGCAAACCCTGGGAGAAGGTGCCTAT
NM_001274.5         ATGGCAGTGCCCTTTGTGGAAGACTGGGACTTGGTGCAAACCCTGGGAGAAGGTGCCTAT
                    ************************************************************

HsCD00000170        GGAGAAGTTCAACTTGCTGTGAATAGAGTAACTGAAGAAGCAGTCGCAGTGAAGATTGTA
NM_001114121.2      GGAGAAGTTCAACTTGCTGTGAATAGAGTAACTGAAGAAGCAGTCGCAGTGAAGATTGTA
NM_001244846.1      GGAGAAGTTCAACTTGCTGTGAATAGAGTAACTGAAGAAGCAGTCGCAGTGAAGATTGTA
NM_001114122.2      GGAGAAGTTCAACTTGCTGTGAATAGAGTAACTGAAGAAGCAGTCGCAGTGAAGATTGTA
NM_001274.5         GGAGAAGTTCAACTTGCTGTGAATAGAGTAACTGAAGAAGCAGTCGCAGTGAAGATTGTA
                    ************************************************************

HsCD00000170        GATATGAAGCGTGCCGTAGACTGTCCAGAAAATATTAAGAAAGAGATCTGTATCAATAAA
NM_001114121.2      GATATGAAGCGTGCCGTAGACTGTCCAGAAAATATTAAGAAAGAGATCTGTATCAATAAA
NM_001244846.1      GATATGAAGCGTGCCGTAGACTGTCCAGAAAATATTAAGAAAGAGATCTGTATCAATAAA
NM_001114122.2      GATATGAAGCGTGCCGTAGACTGTCCAGAAAATATTAAGAAAGAGATCTGTATCAATAAA
NM_001274.5         GATATGAAGCGTGCCGTAGACTGTCCAGAAAATATTAAGAAAGAGATCTGTATCAATAAA
                    ************************************************************

HsCD00000170        ATGCTAAATCATGAAAATGTAGTAAAATTCTATGGTCACAGGAGAGAAGGCAATATCCAA
NM_001114121.2      ATGCTAAATCATGAAAATGTAGTAAAATTCTATGGTCACAGGAGAGAAGGCAATATCCAA
NM_001244846.1      ATGCTAAATCATGAAAATGTAGTAAAATTCTATGGTCACAGGAGAGAAGGCAATATCCAA
NM_001114122.2      ATGCTAAATCATGAAAATGTAGTAAAATTCTATGGTCACAGGAGAGAAGGCAATATCCAA
NM_001274.5         ATGCTAAATCATGAAAATGTAGTAAAATTCTATGGTCACAGGAGAGAAGGCAATATCCAA
                    ************************************************************

HsCD00000170        TATTTATTTCTGGAGTACTGTAGTGGAGGAGAGCTTTTTGACAGAATAGAGCCAGACATA
NM_001114121.2      TATTTATTTCTGGAGTACTGTAGTGGAGGAGAGCTTTTTGACAGAATAGAGCCAGACATA
NM_001244846.1      TATTTATTTCTGGAGTACTGTAGTGGAGGAGAGCTTTTTGACAGAATAGAGCCAGACATA
NM_001114122.2      TATTTATTTCTGGAGTACTGTAGTGGAGGAGAGCTTTTTGACAGAATAGAGCCAGACATA
NM_001274.5         TATTTATTTCTGGAGTACTGTAGTGGAGGAGAGCTTTTTGACAGAATAGAGCCAGACATA
                    ************************************************************

HsCD00000170        GGCATGCCTGAACCAGATGCTCAGAGATTCTTCCATCAACTCATGGCAGGGGTGGTTTAT
NM_001114121.2      GGCATGCCTGAACCAGATGCTCAGAGATTCTTCCATCAACTCATGGCAGGGGTGGTTTAT
NM_001244846.1      GGCATGCCTGAACCAGATGCTCAGAGATTCTTCCATCAACTCATGGCAGGGGTGGTTTAT
NM_001114122.2      GGCATGCCTGAACCAGATGCTCAGAGATTCTTCCATCAACTCATGGCAGGGGTGGTTTAT
NM_001274.5         GGCATGCCTGAACCAGATGCTCAGAGATTCTTCCATCAACTCATGGCAGGGGTGGTTTAT
                    ************************************************************

HsCD00000170        CTGCATGGTATTGGAATAACTCACAGGGATATTAAACCAGAAAATCTTCTGTTGGATGAA
NM_001114121.2      CTGCATGGTATTGGAATAACTCACAGGGATATTAAACCAGAAAATCTTCTGTTGGATGAA
NM_001244846.1      CTGCATGGTATTGGAATAACTCACAGGGATATTAAACCAGAAAATCTTCTGTTGGATGAA
NM_001114122.2      CTGCATGGTATTGGAATAACTCACAGGGATATTAAACCAGAAAATCTTCTGTTGGATGAA
NM_001274.5         CTGCATGGTATTGGAATAACTCACAGGGATATTAAACCAGAAAATCTTCTGTTGGATGAA
                    ************************************************************

HsCD00000170        AGGGATAACCTCAAAATCTCAGACTTTGGCTTGGCAACAGTATTTCGGTATAATAATCGT
NM_001114121.2      AGGGATAACCTCAAAATCTCAGACTTTGGCTTGGCAACAGTATTTCGGTATAATAATCGT
NM_001244846.1      AGGGATAACCTCAAAATCTCAGACTTTGGCTTGGCAACAGTATTTCGGTATAATAATCGT
NM_001114122.2      AGGGATAACCTCAAAATCTCAGACTTTGGCTTGGCAACAGTATTTCGGTATAATAATCGT
NM_001274.5         AGGGATAACCTCAAAATCTCAGACTTTGGCTTGGCAACAGTATTTCGGTATAATAATCGT
                    ************************************************************

HsCD00000170        GAGCGTTTGTTGAACAAGATGTGTGGTACTTTACCATATGTTGCTCCAGAACTTCTGAAG
NM_001114121.2      GAGCGTTTGTTGAACAAGATGTGTGGTACTTTACCATATGTTGCTCCAGAACTTCTGAAG
NM_001244846.1      GAGCGTTTGTTGAACAAGATGTGTGGTACTTTACCATATGTTGCTCCAGAACTTCTGAAG
NM_001114122.2      GAGCGTTTGTTGAACAAGATGTGTGGTACTTTACCATATGTTGCTCCAGAACTTCTGAAG
NM_001274.5         GAGCGTTTGTTGAACAAGATGTGTGGTACTTTACCATATGTTGCTCCAGAACTTCTGAAG
                    ************************************************************

HsCD00000170        AGAAGAGAATTTCATGCAGAACCAGTTGATGTTTGGTCCTGTGGAATAGTACTTACTGCA
NM_001114121.2      AGAAGAGAATTTCATGCAGAACCAGTTGATGTTTGGTCCTGTGGAATAGTACTTACTGCA
NM_001244846.1      AGAAGAGAATTTCATGCAGAACCAGTTGATGTTTGGTCCTGTGGAATAGTACTTACTGCA
NM_001114122.2      AGAAGAGAATTTCATGCAGAACCAGTTGATGTTTGGTCCTGTGGAATAGTACTTACTGCA
NM_001274.5         AGAAGAGAATTTCATGCAGAACCAGTTGATGTTTGGTCCTGTGGAATAGTACTTACTGCA
                    ************************************************************

HsCD00000170        ATGCTCGCTGGAGAATTGCCATGGGACCAACCCAGTGACAGCTGTCAGGAGTATTCTGAC
NM_001114121.2      ATGCTCGCTGGAGAATTGCCATGGGACCAACCCAGTGACAGCTGTCAGGAGTATTCTGAC
NM_001244846.1      ATGCTCGCTGGAGAATTGCCATGGGACCAACCCAGTGACAGCTGTCAGGAGTATTCTGAC
NM_001114122.2      ATGCTCGCTGGAGAATTGCCATGGGACCAACCCAGTGACAGCTGTCAGGAGTATTCTGAC
NM_001274.5         ATGCTCGCTGGAGAATTGCCATGGGACCAACCCAGTGACAGCTGTCAGGAGTATTCTGAC
                    ************************************************************

HsCD00000170        TGGAAAGAAAAAAAAACATACCTCAACCCTTGGAAAAAAATCGATTCTGCTCCTCTAGCT
NM_001114121.2      TGGAAAGAAAAAAAAACATACCTCAACCCTTGGAAAAAAATCGATTCTGCTCCTCTAGCT
NM_001244846.1      TGGAAAGAAAAAAAAACATACCTCAACCCTTGGAAAAAAATCGATTCTGCTCCTCTAGCT
NM_001114122.2      TGGAAAGAAAAAAAAACATACCTCAACCCTTGGAAAAAAATCGATTCTGCTCCTCTAGCT
NM_001274.5         TGGAAAGAAAAAAAAACATACCTCAACCCTTGGAAAAAAATCGATTCTGCTCCTCTAGCT
                    ************************************************************

HsCD00000170        CTGCTGCATAAAATCTTAGTTGAGAATCCATCAGCAAGAATTACCATTCCAGACATCAAA
NM_001114121.2      CTGCTGCATAAAATCTTAGTTGAGAATCCATCAGCAAGAATTACCATTCCAGACATCAAA
NM_001244846.1      CTGCTGCATAAAATCTTAGTTGAGAATCCATCAGCAAGAATTACCATTCCAGACATCAAA
NM_001114122.2      CTGCTGCATAAAATCTTAGTTGAGAATCCATCAGCAAGAATTACCATTCCAGACATCAAA
NM_001274.5         CTGCTGCATAAAATCTTAGTTGAGAATCCATCAGCAAGAATTACCATTCCAGACATCAAA
                    ************************************************************

HsCD00000170        AAAGATAGATGGTACAACAAACCCCTCAAGAAAGGGGCAAAAAGGCCCCGAGTCACTTCA
NM_001114121.2      AAAGATAGATGGTACAACAAACCCCTCAAGAAAGGGGCAAAAAGGCCCCGAGTCACTTCA
NM_001244846.1      AAAGATAGATGGTACAACAAACCCCTCAAGAAAGGGGCAAAAAGGCCCCGAGTCACTTCA
NM_001114122.2      AAAGATAGATGGTACAACAAACCCCTCAAGAAAGGGGCAAAAAGGCCCCGAGTCACTTCA
NM_001274.5         AAAGATAGATGGTACAACAAACCCCTCAAGAAAGGGGCAAAAAGGCCCCGAGTCACTTCA
                    ************************************************************

HsCD00000170        GGTGGTGTGTCAGAGTCTCCCAGTGGATTTTCTAAGCACATTCAATCCAATTTGGACTTC
NM_001114121.2      GGTGGTGTGTCAGAGTCTCCCAGTGGATTTTCTAAGCACATTCAATCCAATTTGGACTTC
NM_001244846.1      GGTGGTGTGTCAGAGTCTCCCAGTGGATTTTCTAAGCACATTCAATCCAATTTGGACTTC
NM_001114122.2      GGTGGTGTGTCAGAGTCTCCCAGTGGATTTTCTAAGCACATTCAATCCAATTTGGACTTC
NM_001274.5         GGTGGTGTGTCAGAGTCTCCCAGTGGATTTTCTAAGCACATTCAATCCAATTTGGACTTC
                    ************************************************************

HsCD00000170        TCTCCAGTAAACAGTGCTTCTAGTGAAGAAAATGTGAAGTACTCCAGTTCTCAGCCAGAA
NM_001114121.2      TCTCCAGTAAACAGTGCTTCTAGTGAAGAAAATGTGAAGTACTCCAGTTCTCAGCCAGAA
NM_001244846.1      TCTCCAGTAAACAGTGCTTCTAGTGAAGAAAATGTGAAGTACTCCAGTTCTCAGCCAGAA
NM_001114122.2      TCTCCAGTAAACAGTGCTTCTAGTGAAGAAAATGTGAAGTACTCCAGTTCTCAGCCAGAA
NM_001274.5         TCTCCAGTAAACAGTGCTTCTAGTGAAGAAAATGTGAAGTACTCCAGTTCTCAGCCAGAA
                    ************************************************************

HsCD00000170        CCCCGCACAGGTCTTTCCTTATGGGATACCAGCCCCTCATACATTGATAAATTGGTACAA
NM_001114121.2      CCCCGCACAGGTCTTTCCTTATGGGATACCAGCCCCTCATACATTGATAAATTGGTACAA
NM_001244846.1      CCCCGCACAGGTCTTTCCTTATGGGATACCAGCCCCTCATACATTGATAAATTGGTACAA
NM_001114122.2      CCCCGCACAGGTCTTTCCTTATGGGATACCAGCCCCTCATACATTGATAAATTGGTACAA
NM_001274.5         CCCCGCACAGGTCTTTCCTTATGGGATACCAGCCCCTCATACATTGATAAATTGGTACAA
                    ************************************************************

HsCD00000170        GGGATCAGCTTTTCCCAGCCCACATGTCCTGATCATATGCTTTTGAATAGTCAGTTACTT
NM_001114121.2      GGGATCAGCTTTTCCCAGCCCACATGTCCTGATCATATGCTTTTGAATAGTCAGTTACTT
NM_001244846.1      GGGATCAGCTTTTCCCAGCCCACATGTCCTGATCATATGCTTTTGAATAGTCAGTTACTT
NM_001114122.2      GGGATCAGCTTTTCCCAGCCCACATGTCCTGATCATATGCTTTTGAATAGTCAGTTACTT
NM_001274.5         GGGATCAGCTTTTCCCAGCCCACATGTCCTGATCATATGCTTTTGAATAGTCAGTTACTT
                    ************************************************************

HsCD00000170        GGCACCCCAGGATCCTCACAGAACCCCTGGCAGCGGTTGGTCAAAAGAATGACACGATTC
NM_001114121.2      GGCACCCCAGGATCCTCACAGAACCCCTGGCAGCGGTTGGTCAAAAGAATGACACGATTC
NM_001244846.1      GGCACCCCAGGATCCTCACAGAACCCCTGGCAGCGGTTGGTCAAAAGAATGACACGATTC
NM_001114122.2      GGCACCCCAGGATCCTCACAGAACCCCTGGCAGCGGTTGGTCAAAAGAATGACACGATTC
NM_001274.5         GGCACCCCAGGATCCTCACAGAACCCCTGGCAGCGGTTGGTCAAAAGAATGACACGATTC
                    ************************************************************

HsCD00000170        TTTACCAAATTGGATGCAGACAAATCTTATCAATGCCTGAAAGAGACTTGTGAGAAGTTG
NM_001114121.2      TTTACCAAATTGGATGCAGACAAATCTTATCAATGCCTGAAAGAGACTTGTGAGAAGTTG
NM_001244846.1      TTTACCAAATTGGATGCAGACAAATCTTATCAATGCCTGAAAGAGACTTGTGAGAAGTTG
NM_001114122.2      TTTACCAAATTGGATGCAGACAAATCTTATCAATGCCTGAAAGAGACTTGTGAGAAGTTG
NM_001274.5         TTTACCAAATTGGATGCAGACAAATCTTATCAATGCCTGAAAGAGACTTGTGAGAAGTTG
                    ************************************************************

HsCD00000170        GGCTATCAATGGAAGAAAAGTTGTATGAATCAGGTTACTATATCAACAACTGATAGGAGA
NM_001114121.2      GGCTATCAATGGAAGAAAAGTTGTATGAATCAGGTTACTATATCAACAACTGATAGGAGA
NM_001244846.1      GGCTATCAATGGAAGAAAAGTTGTATGAATCAG---------------------------
NM_001114122.2      GGCTATCAATGGAAGAAAAGTTGTATGAATCAGGTTACTATATCAACAACTGATAGGAGA
NM_001274.5         GGCTATCAATGGAAGAAAAGTTGTATGAATCAGGTTACTATATCAACAACTGATAGGAGA
                    *********************************                           

HsCD00000170        AACAATAAACTCATTTTCAAAGTGAATTTGTTAGAAATGGATGATAAAATATTGGTTGAC
NM_001114121.2      AACAATAAACTCATTTTCAAAGTGAATTTGTTAGAAATGGATGATAAAATATTGGTTGAC
NM_001244846.1      ------------------------------------------------------------
NM_001114122.2      AACAATAAACTCATTTTCAAAGTGAATTTGTTAGAAATGGATGATAAAATATTGGTTGAC
NM_001274.5         AACAATAAACTCATTTTCAAAGTGAATTTGTTAGAAATGGATGATAAAATATTGGTTGAC
                                                                                

HsCD00000170        TTCCGGCTTTCTAAGGGTGATGGATTGGAGTTCAAGAGACACTTCCTGAAGATTAAAGGG
NM_001114121.2      TTCCGGCTTTCTAAGGGTGATGGATTGGAGTTCAAGAGACACTTCCTGAAGATTAAAGGG
NM_001244846.1      ---------------GGTGATGGATTGGAGTTCAAGAGACACTTCCTGAAGATTAAAGGG
NM_001114122.2      TTCCGGCTTTCTAAGGGTGATGGATTGGAGTTCAAGAGACACTTCCTGAAGATTAAAGGG
NM_001274.5         TTCCGGCTTTCTAAGGGTGATGGATTGGAGTTCAAGAGACACTTCCTGAAGATTAAAGGG
                                   *********************************************

HsCD00000170        AAGCTGATTGATATTGTGAGCAGCCAGAAGGTTTGGCTTCCTGCCACATGA
NM_001114121.2      AAGCTGATTGATATTGTGAGCAGCCAGAAGATTTGGCTTCCTGCCACATGA
NM_001244846.1      AAGCTGATTGATATTGTGAGCAGCCAGAAGATTTGGCTTCCTGCCACATGA
NM_001114122.2      AAGCTGATTGATATTGTGAGCAGCCAGAAGATTTGGCTTCCTGCCACATGA
NM_001274.5         AAGCTGATTGATATTGTGAGCAGCCAGAAGATTTGGCTTCCTGCCACATGA
                    ******************************.********************

Pathways

NCI : ATR signaling pathway
NCI : Circadian rhythm pathway
NCI : Fanconi anemia pathway
NCI : p53 pathway
NCI : p73 transcription factor network
Reactome : Activation of ATR in response to replication stress
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Chk1/Chk2(Cds1) mediated inactivation of Cyclin B:Cdk1 complex
Reactome : G1/S DNA Damage Checkpoints
Reactome : G2/M Checkpoints
Reactome : G2/M DNA damage checkpoint
Reactome : Signal Transduction
Reactome : Signaling by SCF-KIT
Reactome : Ubiquitin Mediated Degradation of Phosphorylated Cdc25A
Reactome : p53-Independent DNA Damage Response
Reactome : p53-Independent G1/S DNA damage checkpoint
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : miRNA regulation of DNA Damage Response

Clone

Cloning Information : 117918
HIP Master Clone ID : 93764
Original Clone ID : FLH117918.01X

Organism


TAX_ID : 9606
Species Specific ID: 1111

Genome

Chromosome : 11
Map Location : 11q24.2
Ensembl : ENSG00000149554

Reagents

Labome : Chk1-antibody