DNASU Plasmid Repository • 480.965.5697 | Email

CHEK1 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CHEK1
Gene Name:  checkpoint kinase 1
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH123860.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00000172

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1431nts         Open reading frame : 1 to 1431
Reference Sequence Alignment

ATGGCAGTGCCCTTTGTGGAAGACTGGGACTTGGTGCAAACCCTGGGAGAAGGTGCCTAT
GGAGAAGTTCAACTTGCTGTGAATAGAGTAACTGAAGAAGCAGTCGCAGTGAAGATTGTA
GATATGAAGCGTGCCGTAGACTGTCCAGAAAATATTAAGAAAGAGATCTGTATCAATAAA
ATGCTAAATCATGAAAATGTAGTAAAATTCTATGGTCACAGGAGAGAAGGCAATATCCAA
TATTTATTTCTGGAGTACTGTAGTGGAGGAGAGCTTTTTGACAGAATAGAGCCAGACATA
GGCATGCCTGAACCAGATGCTCAGAGATTCTTCCATCAACTCATGGCAGGGGTGGTTTAT
CTGCATGGTATTGGAATAACTCACAGGGATATTAAACCAGAAAATCTTCTGTTGGATGAA
AGGGATAACCTCAAAATCTCAGACTTTGGCTTGGCAACAGTATTTCGGTATAATAATCGT
GAGCGTTTGTTGAACAAGATGTGTGGTACTTTACCATATGTTGCTCCAGAACTTCTGAAG
AGAAGAGAATTTCATGCAGAACCAGTTGATGTTTGGTCCTGTGGAATAGTACTTACTGCA
ATGCTCGCTGGAGAATTGCCATGGGACCAACCCAGTGACAGCTGTCAGGAGTATTCTGAC
TGGAAAGAAAAAAAAACATACCTCAACCCTTGGAAAAAAATCGATTCTGCTCCTCTAGCT
CTGCTGCATAAAATCTTAGTTGAGAATCCATCAGCAAGAATTACCATTCCAGACATCAAA
AAAGATAGATGGTACAACAAACCCCTCAAGAAAGGGGCAAAAAGGCCCCGAGTCACTTCA
GGTGGTGTGTCAGAGTCTCCCAGTGGATTTTCTAAGCACATTCAATCCAATTTGGACTTC
TCTCCAGTAAACAGTGCTTCTAGTGAAGAAAATGTGAAGTACTCCAGTTCTCAGCCAGAA
CCCCGCACAGGTCTTTCCTTATGGGATACCAGCCCCTCATACATTGATAAATTGGTACAA
GGGATCAGCTTTTCCCAGCCCACATGTCCTGATCATATGCTTTTGAATAGTCAGTTACTT
GGCACCCCAGGATCCTCACAGAACCCCTGGCAGCGGTTGGTCAAAAGAATGACACGATTC
TTTACCAAATTGGATGCAGACAAATCTTATCAATGCCTGAAAGAGACTTGTGAGAAGTTG
GGCTATCAATGGAAGAAAAGTTGTATGAATCAGGTTACTATATCAACAACTGATAGGAGA
AACAATAAACTCATTTTCAAAGTGAATTTGTTAGAAATGGATGATAAAATATTGGTTGAC
TTCCGGCTTTCTAAGGGTGATGGATTGGAGTTCAAGAGACACTTCCTGAAGATTAAAGGG
AAGCTGATTGATATTGTGAGCAGCCAGAAGGTTTGGCTTCCTGCCACATTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1465
Start on reference sequence 35
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CHEK1
Symbol Nomenclature : CHEK1
SYNONYM : CHK1
Designation : CHK1 checkpoint homolog|Checkpoint, S. pombe, homolog of, 1|Chk1-S|cell cycle checkpoint kinase|checkpoint kinase-1|serine/threonine-protein kinase Chk1
Full Nomenclature : checkpoint kinase 1
GENEID : 1111
GI : 60825432
GenBank Accession : AY893682
HGNC : 1925
MIM : 603078
Vega : OTTHUMG00000165853
Target GenBank: NM_001274

 

Reference Sequence Alignment

  

HsCD00000172        ATGGCAGTGCCCTTTGTGGAAGACTGGGACTTGGTGCAAACCCTGGGAGAAGGTGCCTAT
NM_001114121.2      ATGGCAGTGCCCTTTGTGGAAGACTGGGACTTGGTGCAAACCCTGGGAGAAGGTGCCTAT
NM_001244846.1      ATGGCAGTGCCCTTTGTGGAAGACTGGGACTTGGTGCAAACCCTGGGAGAAGGTGCCTAT
NM_001114122.2      ATGGCAGTGCCCTTTGTGGAAGACTGGGACTTGGTGCAAACCCTGGGAGAAGGTGCCTAT
NM_001274.5         ATGGCAGTGCCCTTTGTGGAAGACTGGGACTTGGTGCAAACCCTGGGAGAAGGTGCCTAT
                    ************************************************************

HsCD00000172        GGAGAAGTTCAACTTGCTGTGAATAGAGTAACTGAAGAAGCAGTCGCAGTGAAGATTGTA
NM_001114121.2      GGAGAAGTTCAACTTGCTGTGAATAGAGTAACTGAAGAAGCAGTCGCAGTGAAGATTGTA
NM_001244846.1      GGAGAAGTTCAACTTGCTGTGAATAGAGTAACTGAAGAAGCAGTCGCAGTGAAGATTGTA
NM_001114122.2      GGAGAAGTTCAACTTGCTGTGAATAGAGTAACTGAAGAAGCAGTCGCAGTGAAGATTGTA
NM_001274.5         GGAGAAGTTCAACTTGCTGTGAATAGAGTAACTGAAGAAGCAGTCGCAGTGAAGATTGTA
                    ************************************************************

HsCD00000172        GATATGAAGCGTGCCGTAGACTGTCCAGAAAATATTAAGAAAGAGATCTGTATCAATAAA
NM_001114121.2      GATATGAAGCGTGCCGTAGACTGTCCAGAAAATATTAAGAAAGAGATCTGTATCAATAAA
NM_001244846.1      GATATGAAGCGTGCCGTAGACTGTCCAGAAAATATTAAGAAAGAGATCTGTATCAATAAA
NM_001114122.2      GATATGAAGCGTGCCGTAGACTGTCCAGAAAATATTAAGAAAGAGATCTGTATCAATAAA
NM_001274.5         GATATGAAGCGTGCCGTAGACTGTCCAGAAAATATTAAGAAAGAGATCTGTATCAATAAA
                    ************************************************************

HsCD00000172        ATGCTAAATCATGAAAATGTAGTAAAATTCTATGGTCACAGGAGAGAAGGCAATATCCAA
NM_001114121.2      ATGCTAAATCATGAAAATGTAGTAAAATTCTATGGTCACAGGAGAGAAGGCAATATCCAA
NM_001244846.1      ATGCTAAATCATGAAAATGTAGTAAAATTCTATGGTCACAGGAGAGAAGGCAATATCCAA
NM_001114122.2      ATGCTAAATCATGAAAATGTAGTAAAATTCTATGGTCACAGGAGAGAAGGCAATATCCAA
NM_001274.5         ATGCTAAATCATGAAAATGTAGTAAAATTCTATGGTCACAGGAGAGAAGGCAATATCCAA
                    ************************************************************

HsCD00000172        TATTTATTTCTGGAGTACTGTAGTGGAGGAGAGCTTTTTGACAGAATAGAGCCAGACATA
NM_001114121.2      TATTTATTTCTGGAGTACTGTAGTGGAGGAGAGCTTTTTGACAGAATAGAGCCAGACATA
NM_001244846.1      TATTTATTTCTGGAGTACTGTAGTGGAGGAGAGCTTTTTGACAGAATAGAGCCAGACATA
NM_001114122.2      TATTTATTTCTGGAGTACTGTAGTGGAGGAGAGCTTTTTGACAGAATAGAGCCAGACATA
NM_001274.5         TATTTATTTCTGGAGTACTGTAGTGGAGGAGAGCTTTTTGACAGAATAGAGCCAGACATA
                    ************************************************************

HsCD00000172        GGCATGCCTGAACCAGATGCTCAGAGATTCTTCCATCAACTCATGGCAGGGGTGGTTTAT
NM_001114121.2      GGCATGCCTGAACCAGATGCTCAGAGATTCTTCCATCAACTCATGGCAGGGGTGGTTTAT
NM_001244846.1      GGCATGCCTGAACCAGATGCTCAGAGATTCTTCCATCAACTCATGGCAGGGGTGGTTTAT
NM_001114122.2      GGCATGCCTGAACCAGATGCTCAGAGATTCTTCCATCAACTCATGGCAGGGGTGGTTTAT
NM_001274.5         GGCATGCCTGAACCAGATGCTCAGAGATTCTTCCATCAACTCATGGCAGGGGTGGTTTAT
                    ************************************************************

HsCD00000172        CTGCATGGTATTGGAATAACTCACAGGGATATTAAACCAGAAAATCTTCTGTTGGATGAA
NM_001114121.2      CTGCATGGTATTGGAATAACTCACAGGGATATTAAACCAGAAAATCTTCTGTTGGATGAA
NM_001244846.1      CTGCATGGTATTGGAATAACTCACAGGGATATTAAACCAGAAAATCTTCTGTTGGATGAA
NM_001114122.2      CTGCATGGTATTGGAATAACTCACAGGGATATTAAACCAGAAAATCTTCTGTTGGATGAA
NM_001274.5         CTGCATGGTATTGGAATAACTCACAGGGATATTAAACCAGAAAATCTTCTGTTGGATGAA
                    ************************************************************

HsCD00000172        AGGGATAACCTCAAAATCTCAGACTTTGGCTTGGCAACAGTATTTCGGTATAATAATCGT
NM_001114121.2      AGGGATAACCTCAAAATCTCAGACTTTGGCTTGGCAACAGTATTTCGGTATAATAATCGT
NM_001244846.1      AGGGATAACCTCAAAATCTCAGACTTTGGCTTGGCAACAGTATTTCGGTATAATAATCGT
NM_001114122.2      AGGGATAACCTCAAAATCTCAGACTTTGGCTTGGCAACAGTATTTCGGTATAATAATCGT
NM_001274.5         AGGGATAACCTCAAAATCTCAGACTTTGGCTTGGCAACAGTATTTCGGTATAATAATCGT
                    ************************************************************

HsCD00000172        GAGCGTTTGTTGAACAAGATGTGTGGTACTTTACCATATGTTGCTCCAGAACTTCTGAAG
NM_001114121.2      GAGCGTTTGTTGAACAAGATGTGTGGTACTTTACCATATGTTGCTCCAGAACTTCTGAAG
NM_001244846.1      GAGCGTTTGTTGAACAAGATGTGTGGTACTTTACCATATGTTGCTCCAGAACTTCTGAAG
NM_001114122.2      GAGCGTTTGTTGAACAAGATGTGTGGTACTTTACCATATGTTGCTCCAGAACTTCTGAAG
NM_001274.5         GAGCGTTTGTTGAACAAGATGTGTGGTACTTTACCATATGTTGCTCCAGAACTTCTGAAG
                    ************************************************************

HsCD00000172        AGAAGAGAATTTCATGCAGAACCAGTTGATGTTTGGTCCTGTGGAATAGTACTTACTGCA
NM_001114121.2      AGAAGAGAATTTCATGCAGAACCAGTTGATGTTTGGTCCTGTGGAATAGTACTTACTGCA
NM_001244846.1      AGAAGAGAATTTCATGCAGAACCAGTTGATGTTTGGTCCTGTGGAATAGTACTTACTGCA
NM_001114122.2      AGAAGAGAATTTCATGCAGAACCAGTTGATGTTTGGTCCTGTGGAATAGTACTTACTGCA
NM_001274.5         AGAAGAGAATTTCATGCAGAACCAGTTGATGTTTGGTCCTGTGGAATAGTACTTACTGCA
                    ************************************************************

HsCD00000172        ATGCTCGCTGGAGAATTGCCATGGGACCAACCCAGTGACAGCTGTCAGGAGTATTCTGAC
NM_001114121.2      ATGCTCGCTGGAGAATTGCCATGGGACCAACCCAGTGACAGCTGTCAGGAGTATTCTGAC
NM_001244846.1      ATGCTCGCTGGAGAATTGCCATGGGACCAACCCAGTGACAGCTGTCAGGAGTATTCTGAC
NM_001114122.2      ATGCTCGCTGGAGAATTGCCATGGGACCAACCCAGTGACAGCTGTCAGGAGTATTCTGAC
NM_001274.5         ATGCTCGCTGGAGAATTGCCATGGGACCAACCCAGTGACAGCTGTCAGGAGTATTCTGAC
                    ************************************************************

HsCD00000172        TGGAAAGAAAAAAAAACATACCTCAACCCTTGGAAAAAAATCGATTCTGCTCCTCTAGCT
NM_001114121.2      TGGAAAGAAAAAAAAACATACCTCAACCCTTGGAAAAAAATCGATTCTGCTCCTCTAGCT
NM_001244846.1      TGGAAAGAAAAAAAAACATACCTCAACCCTTGGAAAAAAATCGATTCTGCTCCTCTAGCT
NM_001114122.2      TGGAAAGAAAAAAAAACATACCTCAACCCTTGGAAAAAAATCGATTCTGCTCCTCTAGCT
NM_001274.5         TGGAAAGAAAAAAAAACATACCTCAACCCTTGGAAAAAAATCGATTCTGCTCCTCTAGCT
                    ************************************************************

HsCD00000172        CTGCTGCATAAAATCTTAGTTGAGAATCCATCAGCAAGAATTACCATTCCAGACATCAAA
NM_001114121.2      CTGCTGCATAAAATCTTAGTTGAGAATCCATCAGCAAGAATTACCATTCCAGACATCAAA
NM_001244846.1      CTGCTGCATAAAATCTTAGTTGAGAATCCATCAGCAAGAATTACCATTCCAGACATCAAA
NM_001114122.2      CTGCTGCATAAAATCTTAGTTGAGAATCCATCAGCAAGAATTACCATTCCAGACATCAAA
NM_001274.5         CTGCTGCATAAAATCTTAGTTGAGAATCCATCAGCAAGAATTACCATTCCAGACATCAAA
                    ************************************************************

HsCD00000172        AAAGATAGATGGTACAACAAACCCCTCAAGAAAGGGGCAAAAAGGCCCCGAGTCACTTCA
NM_001114121.2      AAAGATAGATGGTACAACAAACCCCTCAAGAAAGGGGCAAAAAGGCCCCGAGTCACTTCA
NM_001244846.1      AAAGATAGATGGTACAACAAACCCCTCAAGAAAGGGGCAAAAAGGCCCCGAGTCACTTCA
NM_001114122.2      AAAGATAGATGGTACAACAAACCCCTCAAGAAAGGGGCAAAAAGGCCCCGAGTCACTTCA
NM_001274.5         AAAGATAGATGGTACAACAAACCCCTCAAGAAAGGGGCAAAAAGGCCCCGAGTCACTTCA
                    ************************************************************

HsCD00000172        GGTGGTGTGTCAGAGTCTCCCAGTGGATTTTCTAAGCACATTCAATCCAATTTGGACTTC
NM_001114121.2      GGTGGTGTGTCAGAGTCTCCCAGTGGATTTTCTAAGCACATTCAATCCAATTTGGACTTC
NM_001244846.1      GGTGGTGTGTCAGAGTCTCCCAGTGGATTTTCTAAGCACATTCAATCCAATTTGGACTTC
NM_001114122.2      GGTGGTGTGTCAGAGTCTCCCAGTGGATTTTCTAAGCACATTCAATCCAATTTGGACTTC
NM_001274.5         GGTGGTGTGTCAGAGTCTCCCAGTGGATTTTCTAAGCACATTCAATCCAATTTGGACTTC
                    ************************************************************

HsCD00000172        TCTCCAGTAAACAGTGCTTCTAGTGAAGAAAATGTGAAGTACTCCAGTTCTCAGCCAGAA
NM_001114121.2      TCTCCAGTAAACAGTGCTTCTAGTGAAGAAAATGTGAAGTACTCCAGTTCTCAGCCAGAA
NM_001244846.1      TCTCCAGTAAACAGTGCTTCTAGTGAAGAAAATGTGAAGTACTCCAGTTCTCAGCCAGAA
NM_001114122.2      TCTCCAGTAAACAGTGCTTCTAGTGAAGAAAATGTGAAGTACTCCAGTTCTCAGCCAGAA
NM_001274.5         TCTCCAGTAAACAGTGCTTCTAGTGAAGAAAATGTGAAGTACTCCAGTTCTCAGCCAGAA
                    ************************************************************

HsCD00000172        CCCCGCACAGGTCTTTCCTTATGGGATACCAGCCCCTCATACATTGATAAATTGGTACAA
NM_001114121.2      CCCCGCACAGGTCTTTCCTTATGGGATACCAGCCCCTCATACATTGATAAATTGGTACAA
NM_001244846.1      CCCCGCACAGGTCTTTCCTTATGGGATACCAGCCCCTCATACATTGATAAATTGGTACAA
NM_001114122.2      CCCCGCACAGGTCTTTCCTTATGGGATACCAGCCCCTCATACATTGATAAATTGGTACAA
NM_001274.5         CCCCGCACAGGTCTTTCCTTATGGGATACCAGCCCCTCATACATTGATAAATTGGTACAA
                    ************************************************************

HsCD00000172        GGGATCAGCTTTTCCCAGCCCACATGTCCTGATCATATGCTTTTGAATAGTCAGTTACTT
NM_001114121.2      GGGATCAGCTTTTCCCAGCCCACATGTCCTGATCATATGCTTTTGAATAGTCAGTTACTT
NM_001244846.1      GGGATCAGCTTTTCCCAGCCCACATGTCCTGATCATATGCTTTTGAATAGTCAGTTACTT
NM_001114122.2      GGGATCAGCTTTTCCCAGCCCACATGTCCTGATCATATGCTTTTGAATAGTCAGTTACTT
NM_001274.5         GGGATCAGCTTTTCCCAGCCCACATGTCCTGATCATATGCTTTTGAATAGTCAGTTACTT
                    ************************************************************

HsCD00000172        GGCACCCCAGGATCCTCACAGAACCCCTGGCAGCGGTTGGTCAAAAGAATGACACGATTC
NM_001114121.2      GGCACCCCAGGATCCTCACAGAACCCCTGGCAGCGGTTGGTCAAAAGAATGACACGATTC
NM_001244846.1      GGCACCCCAGGATCCTCACAGAACCCCTGGCAGCGGTTGGTCAAAAGAATGACACGATTC
NM_001114122.2      GGCACCCCAGGATCCTCACAGAACCCCTGGCAGCGGTTGGTCAAAAGAATGACACGATTC
NM_001274.5         GGCACCCCAGGATCCTCACAGAACCCCTGGCAGCGGTTGGTCAAAAGAATGACACGATTC
                    ************************************************************

HsCD00000172        TTTACCAAATTGGATGCAGACAAATCTTATCAATGCCTGAAAGAGACTTGTGAGAAGTTG
NM_001114121.2      TTTACCAAATTGGATGCAGACAAATCTTATCAATGCCTGAAAGAGACTTGTGAGAAGTTG
NM_001244846.1      TTTACCAAATTGGATGCAGACAAATCTTATCAATGCCTGAAAGAGACTTGTGAGAAGTTG
NM_001114122.2      TTTACCAAATTGGATGCAGACAAATCTTATCAATGCCTGAAAGAGACTTGTGAGAAGTTG
NM_001274.5         TTTACCAAATTGGATGCAGACAAATCTTATCAATGCCTGAAAGAGACTTGTGAGAAGTTG
                    ************************************************************

HsCD00000172        GGCTATCAATGGAAGAAAAGTTGTATGAATCAGGTTACTATATCAACAACTGATAGGAGA
NM_001114121.2      GGCTATCAATGGAAGAAAAGTTGTATGAATCAGGTTACTATATCAACAACTGATAGGAGA
NM_001244846.1      GGCTATCAATGGAAGAAAAGTTGTATGAATCAG---------------------------
NM_001114122.2      GGCTATCAATGGAAGAAAAGTTGTATGAATCAGGTTACTATATCAACAACTGATAGGAGA
NM_001274.5         GGCTATCAATGGAAGAAAAGTTGTATGAATCAGGTTACTATATCAACAACTGATAGGAGA
                    *********************************                           

HsCD00000172        AACAATAAACTCATTTTCAAAGTGAATTTGTTAGAAATGGATGATAAAATATTGGTTGAC
NM_001114121.2      AACAATAAACTCATTTTCAAAGTGAATTTGTTAGAAATGGATGATAAAATATTGGTTGAC
NM_001244846.1      ------------------------------------------------------------
NM_001114122.2      AACAATAAACTCATTTTCAAAGTGAATTTGTTAGAAATGGATGATAAAATATTGGTTGAC
NM_001274.5         AACAATAAACTCATTTTCAAAGTGAATTTGTTAGAAATGGATGATAAAATATTGGTTGAC
                                                                                

HsCD00000172        TTCCGGCTTTCTAAGGGTGATGGATTGGAGTTCAAGAGACACTTCCTGAAGATTAAAGGG
NM_001114121.2      TTCCGGCTTTCTAAGGGTGATGGATTGGAGTTCAAGAGACACTTCCTGAAGATTAAAGGG
NM_001244846.1      ---------------GGTGATGGATTGGAGTTCAAGAGACACTTCCTGAAGATTAAAGGG
NM_001114122.2      TTCCGGCTTTCTAAGGGTGATGGATTGGAGTTCAAGAGACACTTCCTGAAGATTAAAGGG
NM_001274.5         TTCCGGCTTTCTAAGGGTGATGGATTGGAGTTCAAGAGACACTTCCTGAAGATTAAAGGG
                                   *********************************************

HsCD00000172        AAGCTGATTGATATTGTGAGCAGCCAGAAGGTTTGGCTTCCTGCCACATTG
NM_001114121.2      AAGCTGATTGATATTGTGAGCAGCCAGAAGATTTGGCTTCCTGCCACATGA
NM_001244846.1      AAGCTGATTGATATTGTGAGCAGCCAGAAGATTTGGCTTCCTGCCACATGA
NM_001114122.2      AAGCTGATTGATATTGTGAGCAGCCAGAAGATTTGGCTTCCTGCCACATGA
NM_001274.5         AAGCTGATTGATATTGTGAGCAGCCAGAAGATTTGGCTTCCTGCCACATGA
                    ******************************.****************** .

Pathways

NCI : ATR signaling pathway
NCI : Circadian rhythm pathway
NCI : Fanconi anemia pathway
NCI : p53 pathway
NCI : p73 transcription factor network
Reactome : Activation of ATR in response to replication stress
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Chk1/Chk2(Cds1) mediated inactivation of Cyclin B:Cdk1 complex
Reactome : G1/S DNA Damage Checkpoints
Reactome : G2/M Checkpoints
Reactome : G2/M DNA damage checkpoint
Reactome : Signal Transduction
Reactome : Signaling by SCF-KIT
Reactome : Ubiquitin Mediated Degradation of Phosphorylated Cdc25A
Reactome : p53-Independent DNA Damage Response
Reactome : p53-Independent G1/S DNA damage checkpoint
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : miRNA regulation of DNA Damage Response

Clone

Cloning Information : 123860
HIP Master Clone ID : 99862
Original Clone ID : FLH123860.01L

Organism


TAX_ID : 9606
Species Specific ID: 1111

Genome

Chromosome : 11
Map Location : 11q24.2
Ensembl : ENSG00000149554

Reagents

Labome : Chk1-antibody