DNASU Plasmid Repository • 480.965.5697 | Email

PTTG1 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PTTG1
Gene Name:  pituitary tumor-transforming 1
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH131040.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00001725

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 609nts         Open reading frame : 1 to 609
Reference Sequence Alignment

ATGGCTACTCTGATCTATGTTGATAAGGAAAACGGAGAACCAGGCACCCGTGTGGTTGCT
AAGGATGGGCTGAAGCTGGGGTCTGGACCTTCAATCAAAGCCTTAGATGGGAGATCTCAA
GTTTCAACACCACGTTTTGGCAAAACGTTCGATGCCCCACCAGCCTTACCTAAAGCTACT
AGAAAGGCTTTGGGAACTGTCAACAGAGCTACAGAAAAGTCTGTAAAGACCAAGGGACCC
CTCAAACAAAAACAGCCAAGCTTTTCTGCCAAAAAGATGACTGAGAAGACTGTTAAAGCA
AAAAGCTCTGTTCCTGCCTCAGATGATGCCTATCCAGAAATAGAAAAATTCTTTCCCTTC
AATCCTCTAGACTTTGAGAGTTTTGACCTGCCTGAAGAGCACCAGATTGCGCACCTCCCC
TTGAGTGGAGTGCCTCTCATGATCCTTGACGAGGAGAGAGAGCTTGAAAAGCTGTTTCAG
CTGGGCCCCCCTTCACCTGTGAAGATGCCCTCTCCACCATGGGAATCCAATCTGTTACAG
TCTCCTTCAAGCATTCTGTCGACCCTGGATGTTGAATTGCCACCTGTTTGCTGTGACATA
GATATTGAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 654
Start on reference sequence 46
Mutations:
None
Discrepancy:
t33c; g537a
                                

5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PTTG1
Symbol Nomenclature : PTTG1
SYNONYM : EAP1; HPTTG; PTTG; TUTR1
Designation : ESP1-associated protein 1|pituitary tumor-transforming gene 1 protein|securin|tumor-transforming protein 1
Full Nomenclature : pituitary tumor-transforming 1
GENEID : 9232
GI : 60829883
GenBank Accession : AY893862
HGNC : 9690
MIM : 604147
Vega : OTTHUMG00000130328
Target GenBank: NM_004219

 

Reference Sequence Alignment

  

HsCD00001725        ATGGCTACTCTGATCTATGTTGATAAGGAAAACGGAGAACCAGGCACCCGTGTGGTTGCT
NM_001282383.1      ATGGCTACTCTGATCTATGTTGATAAGGAAAATGGAGAACCAGGCACCCGTGTGGTTGCT
NM_001282382.1      ATGGCTACTCTGATCTATGTTGATAAGGAAAATGGAGAACCAGGCACCCGTGTGGTTGCT
NM_004219.3         ATGGCTACTCTGATCTATGTTGATAAGGAAAATGGAGAACCAGGCACCCGTGTGGTTGCT
                    ******************************** ***************************

HsCD00001725        AAGGATGGGCTGAAGCTGGGGTCTGGACCTTCAATCAAAGCCTTAGATGGGAGATCTCAA
NM_001282383.1      AAGGATGGGCTGAAGCTGGGGTCTGGACCTTCAATCAAAGCCTTAGATGGGAGATCTCAA
NM_001282382.1      AAGGATGGGCTGAAGCTGGGGTCTGGACCTTCAATCAAAGCCTTAGATGGGAGATCTCAA
NM_004219.3         AAGGATGGGCTGAAGCTGGGGTCTGGACCTTCAATCAAAGCCTTAGATGGGAGATCTCAA
                    ************************************************************

HsCD00001725        GTTTCAACACCACGTTTTGGCAAAACGTTCGATGCCCCACCAGCCTTACCTAAAGCTACT
NM_001282383.1      GTTTCAACACCACGTTTTGGCAAAACGTTCGATGCCCCACCAGCCTTACCTAAAGCTACT
NM_001282382.1      GTTTCAACACCACGTTTTGGCAAAACGTTCGATGCCCCACCAGCCTTACCTAAAGCTACT
NM_004219.3         GTTTCAACACCACGTTTTGGCAAAACGTTCGATGCCCCACCAGCCTTACCTAAAGCTACT
                    ************************************************************

HsCD00001725        AGAAAGGCTTTGGGAACTGTCAACAGAGCTACAGAAAAGTCTGTAAAGACCAAGGGACCC
NM_001282383.1      AGAAAGGCTTTGGGAACTGTCAACAGAGCTACAGAAAAGTCTGTAAAGACCAAGGGACCC
NM_001282382.1      AGAAAGGCTTTGGGAACTGTCAACAGAGCTACAGAAAAGTCTGTAAAGACCAAGGGACCC
NM_004219.3         AGAAAGGCTTTGGGAACTGTCAACAGAGCTACAGAAAAGTCTGTAAAGACCAAGGGACCC
                    ************************************************************

HsCD00001725        CTCAAACAAAAACAGCCAAGCTTTTCTGCCAAAAAGATGACTGAGAAGACTGTTAAAGCA
NM_001282383.1      CTCAAACAAAAACAGCCAAGCTTTTCTGCCAAAAAGATGACTGAGAAGACTGTTAAAGCA
NM_001282382.1      CTCAAACAAAAACAGCCAAGCTTTTCTGCCAAAAAGATGACTGAGAAGACTGTTAAAGCA
NM_004219.3         CTCAAACAAAAACAGCCAAGCTTTTCTGCCAAAAAGATGACTGAGAAGACTGTTAAAGCA
                    ************************************************************

HsCD00001725        AAAAGCTCTGTTCCTGCCTCAGATGATGCCTATCCAGAAATAGAAAAATTCTTTCCCTTC
NM_001282383.1      AAAAGCTCTGTTCCTGCCTCAGATGATGCCTATCCAGAAATAGAAAAATTCTTTCCCTTC
NM_001282382.1      AAAAGCTCTGTTCCTGCCTCAGATGATGCCTATCCAGAAATAGAAAAATTCTTTCCCTTC
NM_004219.3         AAAAGCTCTGTTCCTGCCTCAGATGATGCCTATCCAGAAATAGAAAAATTCTTTCCCTTC
                    ************************************************************

HsCD00001725        AATCCTCTAGACTTTGAGAGTTTTGACCTGCCTGAAGAGCACCAGATTGCGCACCTCCCC
NM_001282383.1      AATCCTCTAGACTTTGAGAGTTTTGACCTGCCTGAAGAGCACCAGATTGCGCACCTCCCC
NM_001282382.1      AATCCTCTAGACTTTGAGAGTTTTGACCTGCCTGAAGAGCACCAGATTGCGCACCTCCCC
NM_004219.3         AATCCTCTAGACTTTGAGAGTTTTGACCTGCCTGAAGAGCACCAGATTGCGCACCTCCCC
                    ************************************************************

HsCD00001725        TTGAGTGGAGTGCCTCTCATGATCCTTGACGAGGAGAGAGAGCTTGAAAAGCTGTTTCAG
NM_001282383.1      TTGAGTGGAGTGCCTCTCATGATCCTTGACGAGGAGAGAGAGCTTGAAAAGCTGTTTCAG
NM_001282382.1      TTGAGTGGAGTGCCTCTCATGATCCTTGACGAGGAGAGAGAGCTTGAAAAGCTGTTTCAG
NM_004219.3         TTGAGTGGAGTGCCTCTCATGATCCTTGACGAGGAGAGAGAGCTTGAAAAGCTGTTTCAG
                    ************************************************************

HsCD00001725        CTGGGCCCCCCTTCACCTGTGAAGATGCCCTCTCCACCATGGGAATCCAATCTGTTACAG
NM_001282383.1      CTGGGCCCCCCTTCACCTGTGAAGATGCCCTCTCCACCATGGGAATCCAATCTGTTGCAG
NM_001282382.1      CTGGGCCCCCCTTCACCTGTGAAGATGCCCTCTCCACCATGGGAATCCAATCTGTTGCAG
NM_004219.3         CTGGGCCCCCCTTCACCTGTGAAGATGCCCTCTCCACCATGGGAATCCAATCTGTTGCAG
                    ********************************************************.***

HsCD00001725        TCTCCTTCAAGCATTCTGTCGACCCTGGATGTTGAATTGCCACCTGTTTGCTGTGACATA
NM_001282383.1      TCTCCTTCAAGCATTCTGTCGACCCTGGATGTTGAATTGCCACCTGTTTGCTGTGACATA
NM_001282382.1      TCTCCTTCAAGCATTCTGTCGACCCTGGATGTTGAATTGCCACCTGTTTGCTGTGACATA
NM_004219.3         TCTCCTTCAAGCATTCTGTCGACCCTGGATGTTGAATTGCCACCTGTTTGCTGTGACATA
                    ************************************************************

HsCD00001725        GATATTGAC
NM_001282383.1      GATATTTAA
NM_001282382.1      GATATTTAA
NM_004219.3         GATATTTAA
                    ****** *.

Pathways

Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : APC/C:Cdc20 mediated degradation of Securin
Reactome : APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : APC/C:Cdh1 mediated degradation of Cdc20 and other APC/C:Cdh1 targeted proteins in late mitosis/early G1
Reactome : Activation of APC/C and APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : M Phase
Reactome : Mitotic Anaphase
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Metaphase and Anaphase
Reactome : Regulation of mitotic cell cycle
Reactome : Separation of Sister Chromatids
WikiPathway : Cell cycle

Protein

UniProt : O95997
UniProt : Q6IAL9
HPRD : 04998

Clone

Cloning Information : 131040
HIP Master Clone ID : 107197
Original Clone ID : FLH131040.01L

Organism


TAX_ID : 9606
Species Specific ID: 9232

Genome

Chromosome : 5
Map Location : 5q35.1
Ensembl : ENSG00000164611

Reagents

Labome : PTTG1-antibody