DNASU Plasmid Repository • 480.965.5697 | Email

MADH4 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SMAD4
Gene Name:  SMAD family member 4
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH023388.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00001812

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1659nts         Open reading frame : 1 to 1659
Reference Sequence Alignment

ATGGACAATATGTCTATTACGAATACACCAACAAGTAATGATGCCTGTCTGAGCATTGTG
CATAGTTTGATGTGCCATAGACAAGGTGGAGAGAGTGAAACATTTGCAAAAAGAGCAATT
GAAAGTTTGGTAAAGAAGCTGAAGGAGAAAAAAGATGAATTGGATTCTTTAATAACAGCT
ATAACTACAAATGGAGCTCATCCTAGTAAATGTGTTACCATACAGAGAACATTGGATGGG
AGGCTTCAGGTGGCTGGTCGGAAAGGATTTCCTCATGTGATCTATGCCCGTCTCTGGAGG
TGGCCTGATCTTCACAAAAATGAACTAAAACATGTTAAATATTGTCAGTATGCGTTTGAC
TTAAAATGTGATAGTGTCTGTGTGAATCCATATCACTACGAACGAGTTGTATCACCTGGA
ATTGATCTCTCAGGATTAACACTGCAGAGTAATGCTCCATCAAGTATGATGGTGAAGGAT
GAATATGTGCATGACTTTGAGGGACAGCCATCGTTGTCCACTGAAGGACATTCAATTCAA
ACCATCCAGCATCCACCAAGTAATCGTGCATCGACAGAGACATACAGCACCCCAGCTCTG
TTAGCCCCATCTGAGTCTAATGCTACCAGCACTGCCAACTTTCCCAACATTCCTGTGGCT
TCCACAAGTCAGCCTGCCAGTATACTGGGGGGCAGCCATAGTGAAGGACTGTTGCAGATA
GCATCAGGGCCTCAGCCAGGACAGCAGCAGAATGGATTTACTGGTCAGCCAGCTACTTAC
CATCATAACAGCACTACCACCTGGACTGGAAGTAGGACTGCACCATACACACCTAATTTG
CCTCACCACCAAAACGGCCATCTTCAGCACCACCCGCCTATGCCGCCCCATCCCGGACAT
TACTGGCCTGTTCACAATGAGCTTGCATTCCAGCCTCCCATTTCCAATCATCCTGCTCCT
GAGTATTGGTGTTCCATTGCTTACTTTGAAATGGATGTTCAGGTAGGAGAGACATTTAAG
GTTCCTTCAAGCTGCCCTATTGTTACTGTTGATGGATACGTGGACCCTTCTGGAGGAGAT
CGCTTTTGTTTGGGTCAACTCTCCAATGTCCACAGGACAGAAGCCATTGAGAGAGCAAGG
TTGCACATAGGCAAAGGTGTGCAGTTGGAATGTAAAGGTGAAGGTGATGTTTGGGTCAGG
TGCCTTAGTGACCACGCGGTCTTTGTACAGAGTTACTACTTAGACAGAGAAGCTGGGCGT
GCACCTGGAGATGCTGTTCATAAGATCTACCCAAGTGCATATATAAAGGTCTTTGATTTG
CGTCAGTGTCATCGACAGATGCAGCAGCAGGCGGCTACTGCACAAGCTGCAGCAGCTGCC
CAGGCAGCAGCCGTGGCAGGAAACATCCCTGGCCCAGGATCAGTAGGTGGAATAGCTCCA
GCTATCAGTCTGTCAGCTGCTGCTGGAATTGGTGTTGATGACCTTCGTCGCTTATGCATA
CTCAGGATGAGTTTTGTGAAAGGCTGGGGACCGGATTACCCAAGACAGAGCATCAAAGAA
ACACCTTGCTGGATTGAAATTCACTTACACCGGGCCCTCCAGCTCCTAGACGAAGTACTT
CATACCATGCCGATTGCAGACCCACAACCTTTAGACTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1901
Start on reference sequence 243
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SMAD4
Symbol Nomenclature : SMAD4
SYNONYM : DPC4; JIP; MADH4; MYHRS
Designation : MAD homolog 4|SMAD, mothers against DPP homolog 4|deleted in pancreatic carcinoma locus 4|deletion target in pancreatic carcinoma 4|mothers against decapentaplegic homolog 4|mothers against decapentaplegic, Drosophila, homolog of, 4
Full Nomenclature : SMAD family member 4
GENEID : 4089
GI : 61369367
GenBank Accession : AY891397
HGNC : 6770
MIM : 600993
Vega : OTTHUMG00000132696
Target GenBank: BC002379

 

Reference Sequence Alignment

  

HsCD00001812      ATGGACAATATGTCTATTACGAATACACCAACAAGTAATGATGCCTGTCTGAGCATTGTG
NM_005359.5       ATGGACAATATGTCTATTACGAATACACCAACAAGTAATGATGCCTGTCTGAGCATTGTG
                  ************************************************************

HsCD00001812      CATAGTTTGATGTGCCATAGACAAGGTGGAGAGAGTGAAACATTTGCAAAAAGAGCAATT
NM_005359.5       CATAGTTTGATGTGCCATAGACAAGGTGGAGAGAGTGAAACATTTGCAAAAAGAGCAATT
                  ************************************************************

HsCD00001812      GAAAGTTTGGTAAAGAAGCTGAAGGAGAAAAAAGATGAATTGGATTCTTTAATAACAGCT
NM_005359.5       GAAAGTTTGGTAAAGAAGCTGAAGGAGAAAAAAGATGAATTGGATTCTTTAATAACAGCT
                  ************************************************************

HsCD00001812      ATAACTACAAATGGAGCTCATCCTAGTAAATGTGTTACCATACAGAGAACATTGGATGGG
NM_005359.5       ATAACTACAAATGGAGCTCATCCTAGTAAATGTGTTACCATACAGAGAACATTGGATGGG
                  ************************************************************

HsCD00001812      AGGCTTCAGGTGGCTGGTCGGAAAGGATTTCCTCATGTGATCTATGCCCGTCTCTGGAGG
NM_005359.5       AGGCTTCAGGTGGCTGGTCGGAAAGGATTTCCTCATGTGATCTATGCCCGTCTCTGGAGG
                  ************************************************************

HsCD00001812      TGGCCTGATCTTCACAAAAATGAACTAAAACATGTTAAATATTGTCAGTATGCGTTTGAC
NM_005359.5       TGGCCTGATCTTCACAAAAATGAACTAAAACATGTTAAATATTGTCAGTATGCGTTTGAC
                  ************************************************************

HsCD00001812      TTAAAATGTGATAGTGTCTGTGTGAATCCATATCACTACGAACGAGTTGTATCACCTGGA
NM_005359.5       TTAAAATGTGATAGTGTCTGTGTGAATCCATATCACTACGAACGAGTTGTATCACCTGGA
                  ************************************************************

HsCD00001812      ATTGATCTCTCAGGATTAACACTGCAGAGTAATGCTCCATCAAGTATGATGGTGAAGGAT
NM_005359.5       ATTGATCTCTCAGGATTAACACTGCAGAGTAATGCTCCATCAAGTATGATGGTGAAGGAT
                  ************************************************************

HsCD00001812      GAATATGTGCATGACTTTGAGGGACAGCCATCGTTGTCCACTGAAGGACATTCAATTCAA
NM_005359.5       GAATATGTGCATGACTTTGAGGGACAGCCATCGTTGTCCACTGAAGGACATTCAATTCAA
                  ************************************************************

HsCD00001812      ACCATCCAGCATCCACCAAGTAATCGTGCATCGACAGAGACATACAGCACCCCAGCTCTG
NM_005359.5       ACCATCCAGCATCCACCAAGTAATCGTGCATCGACAGAGACATACAGCACCCCAGCTCTG
                  ************************************************************

HsCD00001812      TTAGCCCCATCTGAGTCTAATGCTACCAGCACTGCCAACTTTCCCAACATTCCTGTGGCT
NM_005359.5       TTAGCCCCATCTGAGTCTAATGCTACCAGCACTGCCAACTTTCCCAACATTCCTGTGGCT
                  ************************************************************

HsCD00001812      TCCACAAGTCAGCCTGCCAGTATACTGGGGGGCAGCCATAGTGAAGGACTGTTGCAGATA
NM_005359.5       TCCACAAGTCAGCCTGCCAGTATACTGGGGGGCAGCCATAGTGAAGGACTGTTGCAGATA
                  ************************************************************

HsCD00001812      GCATCAGGGCCTCAGCCAGGACAGCAGCAGAATGGATTTACTGGTCAGCCAGCTACTTAC
NM_005359.5       GCATCAGGGCCTCAGCCAGGACAGCAGCAGAATGGATTTACTGGTCAGCCAGCTACTTAC
                  ************************************************************

HsCD00001812      CATCATAACAGCACTACCACCTGGACTGGAAGTAGGACTGCACCATACACACCTAATTTG
NM_005359.5       CATCATAACAGCACTACCACCTGGACTGGAAGTAGGACTGCACCATACACACCTAATTTG
                  ************************************************************

HsCD00001812      CCTCACCACCAAAACGGCCATCTTCAGCACCACCCGCCTATGCCGCCCCATCCCGGACAT
NM_005359.5       CCTCACCACCAAAACGGCCATCTTCAGCACCACCCGCCTATGCCGCCCCATCCCGGACAT
                  ************************************************************

HsCD00001812      TACTGGCCTGTTCACAATGAGCTTGCATTCCAGCCTCCCATTTCCAATCATCCTGCTCCT
NM_005359.5       TACTGGCCTGTTCACAATGAGCTTGCATTCCAGCCTCCCATTTCCAATCATCCTGCTCCT
                  ************************************************************

HsCD00001812      GAGTATTGGTGTTCCATTGCTTACTTTGAAATGGATGTTCAGGTAGGAGAGACATTTAAG
NM_005359.5       GAGTATTGGTGTTCCATTGCTTACTTTGAAATGGATGTTCAGGTAGGAGAGACATTTAAG
                  ************************************************************

HsCD00001812      GTTCCTTCAAGCTGCCCTATTGTTACTGTTGATGGATACGTGGACCCTTCTGGAGGAGAT
NM_005359.5       GTTCCTTCAAGCTGCCCTATTGTTACTGTTGATGGATACGTGGACCCTTCTGGAGGAGAT
                  ************************************************************

HsCD00001812      CGCTTTTGTTTGGGTCAACTCTCCAATGTCCACAGGACAGAAGCCATTGAGAGAGCAAGG
NM_005359.5       CGCTTTTGTTTGGGTCAACTCTCCAATGTCCACAGGACAGAAGCCATTGAGAGAGCAAGG
                  ************************************************************

HsCD00001812      TTGCACATAGGCAAAGGTGTGCAGTTGGAATGTAAAGGTGAAGGTGATGTTTGGGTCAGG
NM_005359.5       TTGCACATAGGCAAAGGTGTGCAGTTGGAATGTAAAGGTGAAGGTGATGTTTGGGTCAGG
                  ************************************************************

HsCD00001812      TGCCTTAGTGACCACGCGGTCTTTGTACAGAGTTACTACTTAGACAGAGAAGCTGGGCGT
NM_005359.5       TGCCTTAGTGACCACGCGGTCTTTGTACAGAGTTACTACTTAGACAGAGAAGCTGGGCGT
                  ************************************************************

HsCD00001812      GCACCTGGAGATGCTGTTCATAAGATCTACCCAAGTGCATATATAAAGGTCTTTGATTTG
NM_005359.5       GCACCTGGAGATGCTGTTCATAAGATCTACCCAAGTGCATATATAAAGGTCTTTGATTTG
                  ************************************************************

HsCD00001812      CGTCAGTGTCATCGACAGATGCAGCAGCAGGCGGCTACTGCACAAGCTGCAGCAGCTGCC
NM_005359.5       CGTCAGTGTCATCGACAGATGCAGCAGCAGGCGGCTACTGCACAAGCTGCAGCAGCTGCC
                  ************************************************************

HsCD00001812      CAGGCAGCAGCCGTGGCAGGAAACATCCCTGGCCCAGGATCAGTAGGTGGAATAGCTCCA
NM_005359.5       CAGGCAGCAGCCGTGGCAGGAAACATCCCTGGCCCAGGATCAGTAGGTGGAATAGCTCCA
                  ************************************************************

HsCD00001812      GCTATCAGTCTGTCAGCTGCTGCTGGAATTGGTGTTGATGACCTTCGTCGCTTATGCATA
NM_005359.5       GCTATCAGTCTGTCAGCTGCTGCTGGAATTGGTGTTGATGACCTTCGTCGCTTATGCATA
                  ************************************************************

HsCD00001812      CTCAGGATGAGTTTTGTGAAAGGCTGGGGACCGGATTACCCAAGACAGAGCATCAAAGAA
NM_005359.5       CTCAGGATGAGTTTTGTGAAAGGCTGGGGACCGGATTACCCAAGACAGAGCATCAAAGAA
                  ************************************************************

HsCD00001812      ACACCTTGCTGGATTGAAATTCACTTACACCGGGCCCTCCAGCTCCTAGACGAAGTACTT
NM_005359.5       ACACCTTGCTGGATTGAAATTCACTTACACCGGGCCCTCCAGCTCCTAGACGAAGTACTT
                  ************************************************************

HsCD00001812      CATACCATGCCGATTGCAGACCCACAACCTTTAGACTTG
NM_005359.5       CATACCATGCCGATTGCAGACCCACAACCTTTAGACTGA
                  ************************************* .

Pathways

NCI : ALK1 signaling events
NCI : ALK2 signaling events
NCI : BMP receptor signaling
NCI : HIF-1-alpha transcription factor network
NCI : LKB1 signaling events
NCI : Regulation of cytoplasmic and nuclear SMAD2/3 signaling
NCI : Regulation of nuclear SMAD2/3 signaling
NCI : TGF-beta receptor signaling
NCI : Validated nuclear estrogen receptor alpha network
NCI : Validated targets of C-MYC transcriptional activation
NCI : Validated targets of C-MYC transcriptional repression
Panther : TGF-beta signaling pathway
Panther : Wnt signaling pathway
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downregulation of SMAD2/3:SMAD4 transcriptional activity
Reactome : Gene Expression
Reactome : Generic Transcription Pathway
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD2/SMAD3:SMAD4 heterotrimer regulates transcription
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : Signal Transduction
Reactome : Signaling by Activin
Reactome : Signaling by BMP
Reactome : Signaling by NODAL
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : TGF-beta receptor signaling activates SMADs
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer
Reactome : Transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer
Reactome : Transcriptional regulation of pluripotent stem cells
WikiPathway : Androgen receptor signaling pathway
WikiPathway : BMP signalling and regulation
WikiPathway : Cell cycle
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : Heart Development
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : TGF Beta Signaling Pathway
WikiPathway : TGF beta Signaling Pathway

Clone

Cloning Information : 23388
HIP Master Clone ID : 53764
Original Clone ID : FLH023388.01L

Organism


TAX_ID : 9606
Species Specific ID: 4089

Genome

Chromosome : 18
Map Location : 18q21.1
Ensembl : ENSG00000141646

Reagents

Labome : Smad4-antibody