DNASU Plasmid Repository • 480.965.5697 | Email

EIF3S7 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  EIF3D
Gene Name:  eukaryotic translation initiation factor 3, subunit D
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH026235.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00001822

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1647nts         Open reading frame : 1 to 1647
Reference Sequence Alignment

ATGGCAAAGTTCATGACACCCGTGATCCAGGACAACCCCTCAGGCTGGGGTCCCTGTGCG
GTTCCCGAGCAGTTTCGGGATATGCCCTACCAGCCGTTCAGCAAAGGAGATCGGCTAGGA
AAGGTTGCAGACTGGACAGGAGCCACATACCAAGATAAGAGGTACACAAATAAGTACTCC
TCTCAGTTTGGTGGTGGAAGTCAATATGCTTATTTCCATGAGGAGGATGAAAGTAGCTTC
CAGCTGGTGGATACAGCGCGCACACAGAAGACGGCCTACCAGCGGAATCGAATGAGATTT
GCCCAGAGGAACCTCCGCAGAGACAAAGATCGTCGGAACATGTTGCAGTTCAACCTGCAG
ATCCTGCCTAAGAGTGCCAAACAGAAAGAGAGAGAACGCATTCGACTGCAGAAAAAGTTC
CAGAAACAATTTGGGGTTAGGCAGAAATGGGATCAGAAATCACAGAAACCCCGAGACTCT
TCAGTTGAAGTTCGTAGTGATTGGGAAGTGAAAGAGGAAATGGATTTTCCTCAGTTGATG
AAGATGCGCTACTTGGAAGTATCAGAGCCACAGGACATTGAGTGTTGTGGGGCCCTAGAA
TACTACGACAAAGCCTTTGACCGCATCACCACGAGGAGTGAGAAGCCACTGCGGAGCATC
AAGCGCATCTTCCACACTGTCACCACCACAGACGACCCTGTCATCCGCAAGCTGGCAAAA
ACTCAGGGGAATGTGTTTGCCACTGATGCCATCCTGGCCACGCTGATGAGCTGTACCCGC
TCAGTGTATTCCTGGGATATTGTCGTCCAGAGAGTTGGGTCCAAACTCTTCTTTGACAAG
AGAGACAACTCTGACTTTGACCTCCTGACAGTGAGTGAGACTGCCAATGAGCCCCCTCAA
GATGAAGGTAATTCCTTCAATTCACCCCGCAACCTGGCCATGGAGGCAACCTACATCAAC
CACAATTTCTCCCAGCAGTGCTTGAGAATGGGGAAGGAAAGATACAACTTCCCCAACCCA
AACCCGTTTGTGGAGGACGACATGGATAAGAATGAAATCGCCTCTGTTGCGTACCGTTAC
CGCAGGTGGAAGCTTGGAGATGATATTGACCTTATTGTCCGTTGTGAGCACGATGGCGTC
ATGACTGGAGCCAACGGGGAAGTGTCCTTCATCAACATCAAGACACTCAATGAGTGGGAT
TCCAGGCACTGTAATGGCGTTGACTGGCGTCAGAAGCTGGACTCTCAGCGAGGGGCTGTC
ATTGCCACGGAGCTGAAGAACAACAGCTACAAGTTGGCCCGGTGGACCTGCTGTGCTTTG
CTGGCTGGATCTGAGTACCTCAAGCTTGGTTATGTGTCTCGGTACCACGTGAAAGACTCC
TCACGCCACGTCATCCTAGGCACCCAGCAGTTCAAGCCTAATGAGTTTGCCAGCCAGATC
AACCTGAGCGTGGAGAATGCCTGGGGCATTTTACGCTGCGTCATTGACATCTGCATGAAG
CTGGAGGAGGGCAAATACCTCATCCTCAAGGACCCCAACAAGCAGGTCATCCGTGTCTAC
AGCCTCCCTGATGGCACCTTCAGCTCTGATGAAGATGAGGAGGAAGAGGAGGAGGAAGAA
GAGGAAGAAGAAGAGGAAGAAACTTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1740
Start on reference sequence 94
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : EIF3D
Symbol Nomenclature : EIF3D
SYNONYM : EIF3S7; eIF3-p66; eIF3-zeta
Designation : eIF-3-zeta|eIF3 p66|eukaryotic translation initiation factor 3 subunit 7|eukaryotic translation initiation factor 3 subunit D|eukaryotic translation initiation factor 3, subunit 7 zeta, 66/67kDa|translation initiation factor eIF3 p66 subunit
Full Nomenclature : eukaryotic translation initiation factor 3, subunit D
GENEID : 8664
Locus Tag : RP5-1119A7.12-003
GI : 61359270
GenBank Accession : AY888750
HGNC : 3278
MIM : 603915
Vega : OTTHUMG00000150599
Target GenBank: BC000469

 

Reference Sequence Alignment

  

HsCD00001822      ATGGCAAAGTTCATGACACCCGTGATCCAGGACAACCCCTCAGGCTGGGGTCCCTGTGCG
NM_003753.3       ATGGCAAAGTTCATGACACCCGTGATCCAGGACAACCCCTCAGGCTGGGGTCCCTGTGCG
                  ************************************************************

HsCD00001822      GTTCCCGAGCAGTTTCGGGATATGCCCTACCAGCCGTTCAGCAAAGGAGATCGGCTAGGA
NM_003753.3       GTTCCCGAGCAGTTTCGGGATATGCCCTACCAGCCGTTCAGCAAAGGAGATCGGCTAGGA
                  ************************************************************

HsCD00001822      AAGGTTGCAGACTGGACAGGAGCCACATACCAAGATAAGAGGTACACAAATAAGTACTCC
NM_003753.3       AAGGTTGCAGACTGGACAGGAGCCACATACCAAGATAAGAGGTACACAAATAAGTACTCC
                  ************************************************************

HsCD00001822      TCTCAGTTTGGTGGTGGAAGTCAATATGCTTATTTCCATGAGGAGGATGAAAGTAGCTTC
NM_003753.3       TCTCAGTTTGGTGGTGGAAGTCAATATGCTTATTTCCATGAGGAGGATGAAAGTAGCTTC
                  ************************************************************

HsCD00001822      CAGCTGGTGGATACAGCGCGCACACAGAAGACGGCCTACCAGCGGAATCGAATGAGATTT
NM_003753.3       CAGCTGGTGGATACAGCGCGCACACAGAAGACGGCCTACCAGCGGAATCGAATGAGATTT
                  ************************************************************

HsCD00001822      GCCCAGAGGAACCTCCGCAGAGACAAAGATCGTCGGAACATGTTGCAGTTCAACCTGCAG
NM_003753.3       GCCCAGAGGAACCTCCGCAGAGACAAAGATCGTCGGAACATGTTGCAGTTCAACCTGCAG
                  ************************************************************

HsCD00001822      ATCCTGCCTAAGAGTGCCAAACAGAAAGAGAGAGAACGCATTCGACTGCAGAAAAAGTTC
NM_003753.3       ATCCTGCCTAAGAGTGCCAAACAGAAAGAGAGAGAACGCATTCGACTGCAGAAAAAGTTC
                  ************************************************************

HsCD00001822      CAGAAACAATTTGGGGTTAGGCAGAAATGGGATCAGAAATCACAGAAACCCCGAGACTCT
NM_003753.3       CAGAAACAATTTGGGGTTAGGCAGAAATGGGATCAGAAATCACAGAAACCCCGAGACTCT
                  ************************************************************

HsCD00001822      TCAGTTGAAGTTCGTAGTGATTGGGAAGTGAAAGAGGAAATGGATTTTCCTCAGTTGATG
NM_003753.3       TCAGTTGAAGTTCGTAGTGATTGGGAAGTGAAAGAGGAAATGGATTTTCCTCAGTTGATG
                  ************************************************************

HsCD00001822      AAGATGCGCTACTTGGAAGTATCAGAGCCACAGGACATTGAGTGTTGTGGGGCCCTAGAA
NM_003753.3       AAGATGCGCTACTTGGAAGTATCAGAGCCACAGGACATTGAGTGTTGTGGGGCCCTAGAA
                  ************************************************************

HsCD00001822      TACTACGACAAAGCCTTTGACCGCATCACCACGAGGAGTGAGAAGCCACTGCGGAGCATC
NM_003753.3       TACTACGACAAAGCCTTTGACCGCATCACCACGAGGAGTGAGAAGCCACTGCGGAGCATC
                  ************************************************************

HsCD00001822      AAGCGCATCTTCCACACTGTCACCACCACAGACGACCCTGTCATCCGCAAGCTGGCAAAA
NM_003753.3       AAGCGCATCTTCCACACTGTCACCACCACAGACGACCCTGTCATCCGCAAGCTGGCAAAA
                  ************************************************************

HsCD00001822      ACTCAGGGGAATGTGTTTGCCACTGATGCCATCCTGGCCACGCTGATGAGCTGTACCCGC
NM_003753.3       ACTCAGGGGAATGTGTTTGCCACTGATGCCATCCTGGCCACGCTGATGAGCTGTACCCGC
                  ************************************************************

HsCD00001822      TCAGTGTATTCCTGGGATATTGTCGTCCAGAGAGTTGGGTCCAAACTCTTCTTTGACAAG
NM_003753.3       TCAGTGTATTCCTGGGATATTGTCGTCCAGAGAGTTGGGTCCAAACTCTTCTTTGACAAG
                  ************************************************************

HsCD00001822      AGAGACAACTCTGACTTTGACCTCCTGACAGTGAGTGAGACTGCCAATGAGCCCCCTCAA
NM_003753.3       AGAGACAACTCTGACTTTGACCTCCTGACAGTGAGTGAGACTGCCAATGAGCCCCCTCAA
                  ************************************************************

HsCD00001822      GATGAAGGTAATTCCTTCAATTCACCCCGCAACCTGGCCATGGAGGCAACCTACATCAAC
NM_003753.3       GATGAAGGTAATTCCTTCAATTCACCCCGCAACCTGGCCATGGAGGCAACCTACATCAAC
                  ************************************************************

HsCD00001822      CACAATTTCTCCCAGCAGTGCTTGAGAATGGGGAAGGAAAGATACAACTTCCCCAACCCA
NM_003753.3       CACAATTTCTCCCAGCAGTGCTTGAGAATGGGGAAGGAAAGATACAACTTCCCCAACCCA
                  ************************************************************

HsCD00001822      AACCCGTTTGTGGAGGACGACATGGATAAGAATGAAATCGCCTCTGTTGCGTACCGTTAC
NM_003753.3       AACCCGTTTGTGGAGGACGACATGGATAAGAATGAAATCGCCTCTGTTGCGTACCGTTAC
                  ************************************************************

HsCD00001822      CGCAGGTGGAAGCTTGGAGATGATATTGACCTTATTGTCCGTTGTGAGCACGATGGCGTC
NM_003753.3       CGCAGGTGGAAGCTTGGAGATGATATTGACCTTATTGTCCGTTGTGAGCACGATGGCGTC
                  ************************************************************

HsCD00001822      ATGACTGGAGCCAACGGGGAAGTGTCCTTCATCAACATCAAGACACTCAATGAGTGGGAT
NM_003753.3       ATGACTGGAGCCAACGGGGAAGTGTCCTTCATCAACATCAAGACACTCAATGAGTGGGAT
                  ************************************************************

HsCD00001822      TCCAGGCACTGTAATGGCGTTGACTGGCGTCAGAAGCTGGACTCTCAGCGAGGGGCTGTC
NM_003753.3       TCCAGGCACTGTAATGGCGTTGACTGGCGTCAGAAGCTGGACTCTCAGCGAGGGGCTGTC
                  ************************************************************

HsCD00001822      ATTGCCACGGAGCTGAAGAACAACAGCTACAAGTTGGCCCGGTGGACCTGCTGTGCTTTG
NM_003753.3       ATTGCCACGGAGCTGAAGAACAACAGCTACAAGTTGGCCCGGTGGACCTGCTGTGCTTTG
                  ************************************************************

HsCD00001822      CTGGCTGGATCTGAGTACCTCAAGCTTGGTTATGTGTCTCGGTACCACGTGAAAGACTCC
NM_003753.3       CTGGCTGGATCTGAGTACCTCAAGCTTGGTTATGTGTCTCGGTACCACGTGAAAGACTCC
                  ************************************************************

HsCD00001822      TCACGCCACGTCATCCTAGGCACCCAGCAGTTCAAGCCTAATGAGTTTGCCAGCCAGATC
NM_003753.3       TCACGCCACGTCATCCTAGGCACCCAGCAGTTCAAGCCTAATGAGTTTGCCAGCCAGATC
                  ************************************************************

HsCD00001822      AACCTGAGCGTGGAGAATGCCTGGGGCATTTTACGCTGCGTCATTGACATCTGCATGAAG
NM_003753.3       AACCTGAGCGTGGAGAATGCCTGGGGCATTTTACGCTGCGTCATTGACATCTGCATGAAG
                  ************************************************************

HsCD00001822      CTGGAGGAGGGCAAATACCTCATCCTCAAGGACCCCAACAAGCAGGTCATCCGTGTCTAC
NM_003753.3       CTGGAGGAGGGCAAATACCTCATCCTCAAGGACCCCAACAAGCAGGTCATCCGTGTCTAC
                  ************************************************************

HsCD00001822      AGCCTCCCTGATGGCACCTTCAGCTCTGATGAAGATGAGGAGGAAGAGGAGGAGGAAGAA
NM_003753.3       AGCCTCCCTGATGGCACCTTCAGCTCTGATGAAGATGAGGAGGAAGAGGAGGAGGAAGAA
                  ************************************************************

HsCD00001822      GAGGAAGAAGAAGAGGAAGAAACTTAG
NM_003753.3       GAGGAAGAAGAAGAGGAAGAAACTTAA
                  **************************.

Pathways

Reactome : 3' -UTR-mediated translational regulation
Reactome : Activation of the mRNA upon binding of the cap-binding complex and eIFs, and subsequent binding to 43S
Reactome : Cap-dependent Translation Initiation
Reactome : Eukaryotic Translation Initiation
Reactome : Formation of a pool of free 40S subunits
Reactome : Formation of the ternary complex, and subsequently, the 43S complex
Reactome : GTP hydrolysis and joining of the 60S ribosomal subunit
Reactome : Gene Expression
Reactome : L13a-mediated translational silencing of Ceruloplasmin expression
Reactome : Metabolism of proteins
Reactome : Ribosomal scanning and start codon recognition
Reactome : Translation
Reactome : Translation initiation complex formation
WikiPathway : Translation Factors

Protein

UniProt : O15371
HPRD : 04888

Clone

Cloning Information : 26235
HIP Master Clone ID : 56611
Original Clone ID : FLH026235.01X

Organism


TAX_ID : 9606
Species Specific ID: 8664

Genome

Chromosome : 22
Map Location : 22q13.1
Ensembl : ENSG00000100353

Reagents

Labome : EIF3D-antibody