DNASU Plasmid Repository • 480.965.5697 | Email

EDG1 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  S1PR1
Gene Name:  sphingosine-1-phosphate receptor 1
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH131092.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00000184

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1149nts         Open reading frame : 1 to 1149
Reference Sequence Alignment

ATGGGGCCCACCAGCGTCCCGCTGGTCAAGGCCCACCGCAGCTCGGTCTCTGACTACGTC
AACTATGATATCATCGTCCGGCATTACAACTACACGGGAAAGCTGAATATCAGCGCGGAC
AAGGAGAACAGCATTAAACTGACCTCGGTGGTGTTCATTCTCATCTGCTGCTTTATCATC
CTGGAGAACATCTTTGTCTTGCTGACCATTTGGAAAACCAAGAAATTCCACCGACCCATG
TACTATTTTATTGGCAATCTGGCCCTCTCAGACCTGTTGGCAGGAGTAGCCTACACAGCT
AACCTGCTCTTGTCTGGGGCCACCACCTACAAGCTCACTCCCGCCCAGTGGTTTCTGCGG
GAAGGGAGTATGTTTGTGGCCCTGTCAGCCTCCGTGTTCAGTCTCCTCGCCATCGCCATT
GAGCGCTATATCACAATGCTGAAAATGAAACTCCACAACGGGAGCAATAACTTCCGCCTC
TTCCTGCTAATCAGCGCCTGCTGGGTCATCTCCCTCATCCTGGGTGGCCTGCCTATCATG
GGCTGGAACTGCATCAGTGCGCTGTCCAGCTGCTCCACCGTGCTGCCGCTCTACCACAAG
CACTATATCCTCTTCTGCACCACGGTCTTCACTCTGCTTCTGCTCTCCATCGTCATTCTG
TACTGCAGAATCTACTCCTTGGTCAGGACTCGGAGCCGCCGCCTGACGTTCCGCAAGAAC
ATTTCCAAGGCCAGCCGCAGCTCTGAGAAGTCGCTGGCGCTGCTCAAGACCGTAATTATC
GTCCTGAGCGTCTTCATCGCCTGCTGGGCACCGCTCTTCATCCTGCTCCTGCTGGATGTG
GGCTGCAAGGTGAAGACCTGTGACATCCTCTTCAGAGCGGAGTACTTCCTGGTGTTAGCT
GTGCTCAACTCCGGCACCAACCCCATCATTTACACTCTGACCAACAAGGAGATGCGTCGG
GCCTTCATCCGGATCATGTCCTGCTGCAAGTGCCCGAGCGGAGACTCTGCTGGCAAATTC
AAGCGACCCATCATCGCCGGCATGGAATTCAGCCGCAGCAAATCGGACAATTCCTCCCAC
CCCCAGAAAGACGAAGGGGACAACCCAGAGACCATTATGTCTTCTGGAAACGTCAACTCT
TCTTCCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1392
Start on reference sequence 244
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : S1PR1
Symbol Nomenclature : S1PR1
SYNONYM : CD363; CHEDG1; D1S3362; ECGF1; EDG-1; EDG1; S1P1
Designation : S1P receptor 1|S1P receptor Edg-1|endothelial differentiation G-protein coupled receptor 1|endothelial differentiation, sphingolipid G-protein-coupled receptor, 1|sphingosine 1-phosphate receptor 1|sphingosine 1-phosphate receptor EDG1|sphingosine 1-phosphate receptor Edg-1
Full Nomenclature : sphingosine-1-phosphate receptor 1
GENEID : 1901
GI : 60813368
GenBank Accession : AY893220
HGNC : 3165
MIM : 601974
Vega : OTTHUMG00000010835
Target GenBank: NM_001400

 

Reference Sequence Alignment

  

HsCD00000184      ATGGGGCCCACCAGCGTCCCGCTGGTCAAGGCCCACCGCAGCTCGGTCTCTGACTACGTC
NM_001400.4       ATGGGGCCCACCAGCGTCCCGCTGGTCAAGGCCCACCGCAGCTCGGTCTCTGACTACGTC
                  ************************************************************

HsCD00000184      AACTATGATATCATCGTCCGGCATTACAACTACACGGGAAAGCTGAATATCAGCGCGGAC
NM_001400.4       AACTATGATATCATCGTCCGGCATTACAACTACACGGGAAAGCTGAATATCAGCGCGGAC
                  ************************************************************

HsCD00000184      AAGGAGAACAGCATTAAACTGACCTCGGTGGTGTTCATTCTCATCTGCTGCTTTATCATC
NM_001400.4       AAGGAGAACAGCATTAAACTGACCTCGGTGGTGTTCATTCTCATCTGCTGCTTTATCATC
                  ************************************************************

HsCD00000184      CTGGAGAACATCTTTGTCTTGCTGACCATTTGGAAAACCAAGAAATTCCACCGACCCATG
NM_001400.4       CTGGAGAACATCTTTGTCTTGCTGACCATTTGGAAAACCAAGAAATTCCACCGACCCATG
                  ************************************************************

HsCD00000184      TACTATTTTATTGGCAATCTGGCCCTCTCAGACCTGTTGGCAGGAGTAGCCTACACAGCT
NM_001400.4       TACTATTTTATTGGCAATCTGGCCCTCTCAGACCTGTTGGCAGGAGTAGCCTACACAGCT
                  ************************************************************

HsCD00000184      AACCTGCTCTTGTCTGGGGCCACCACCTACAAGCTCACTCCCGCCCAGTGGTTTCTGCGG
NM_001400.4       AACCTGCTCTTGTCTGGGGCCACCACCTACAAGCTCACTCCCGCCCAGTGGTTTCTGCGG
                  ************************************************************

HsCD00000184      GAAGGGAGTATGTTTGTGGCCCTGTCAGCCTCCGTGTTCAGTCTCCTCGCCATCGCCATT
NM_001400.4       GAAGGGAGTATGTTTGTGGCCCTGTCAGCCTCCGTGTTCAGTCTCCTCGCCATCGCCATT
                  ************************************************************

HsCD00000184      GAGCGCTATATCACAATGCTGAAAATGAAACTCCACAACGGGAGCAATAACTTCCGCCTC
NM_001400.4       GAGCGCTATATCACAATGCTGAAAATGAAACTCCACAACGGGAGCAATAACTTCCGCCTC
                  ************************************************************

HsCD00000184      TTCCTGCTAATCAGCGCCTGCTGGGTCATCTCCCTCATCCTGGGTGGCCTGCCTATCATG
NM_001400.4       TTCCTGCTAATCAGCGCCTGCTGGGTCATCTCCCTCATCCTGGGTGGCCTGCCTATCATG
                  ************************************************************

HsCD00000184      GGCTGGAACTGCATCAGTGCGCTGTCCAGCTGCTCCACCGTGCTGCCGCTCTACCACAAG
NM_001400.4       GGCTGGAACTGCATCAGTGCGCTGTCCAGCTGCTCCACCGTGCTGCCGCTCTACCACAAG
                  ************************************************************

HsCD00000184      CACTATATCCTCTTCTGCACCACGGTCTTCACTCTGCTTCTGCTCTCCATCGTCATTCTG
NM_001400.4       CACTATATCCTCTTCTGCACCACGGTCTTCACTCTGCTTCTGCTCTCCATCGTCATTCTG
                  ************************************************************

HsCD00000184      TACTGCAGAATCTACTCCTTGGTCAGGACTCGGAGCCGCCGCCTGACGTTCCGCAAGAAC
NM_001400.4       TACTGCAGAATCTACTCCTTGGTCAGGACTCGGAGCCGCCGCCTGACGTTCCGCAAGAAC
                  ************************************************************

HsCD00000184      ATTTCCAAGGCCAGCCGCAGCTCTGAGAAGTCGCTGGCGCTGCTCAAGACCGTAATTATC
NM_001400.4       ATTTCCAAGGCCAGCCGCAGCTCTGAGAAGTCGCTGGCGCTGCTCAAGACCGTAATTATC
                  ************************************************************

HsCD00000184      GTCCTGAGCGTCTTCATCGCCTGCTGGGCACCGCTCTTCATCCTGCTCCTGCTGGATGTG
NM_001400.4       GTCCTGAGCGTCTTCATCGCCTGCTGGGCACCGCTCTTCATCCTGCTCCTGCTGGATGTG
                  ************************************************************

HsCD00000184      GGCTGCAAGGTGAAGACCTGTGACATCCTCTTCAGAGCGGAGTACTTCCTGGTGTTAGCT
NM_001400.4       GGCTGCAAGGTGAAGACCTGTGACATCCTCTTCAGAGCGGAGTACTTCCTGGTGTTAGCT
                  ************************************************************

HsCD00000184      GTGCTCAACTCCGGCACCAACCCCATCATTTACACTCTGACCAACAAGGAGATGCGTCGG
NM_001400.4       GTGCTCAACTCCGGCACCAACCCCATCATTTACACTCTGACCAACAAGGAGATGCGTCGG
                  ************************************************************

HsCD00000184      GCCTTCATCCGGATCATGTCCTGCTGCAAGTGCCCGAGCGGAGACTCTGCTGGCAAATTC
NM_001400.4       GCCTTCATCCGGATCATGTCCTGCTGCAAGTGCCCGAGCGGAGACTCTGCTGGCAAATTC
                  ************************************************************

HsCD00000184      AAGCGACCCATCATCGCCGGCATGGAATTCAGCCGCAGCAAATCGGACAATTCCTCCCAC
NM_001400.4       AAGCGACCCATCATCGCCGGCATGGAATTCAGCCGCAGCAAATCGGACAATTCCTCCCAC
                  ************************************************************

HsCD00000184      CCCCAGAAAGACGAAGGGGACAACCCAGAGACCATTATGTCTTCTGGAAACGTCAACTCT
NM_001400.4       CCCCAGAAAGACGAAGGGGACAACCCAGAGACCATTATGTCTTCTGGAAACGTCAACTCT
                  ************************************************************

HsCD00000184      TCTTCCTAG
NM_001400.4       TCTTCCTAG
                  *********

Pathways

NCI : Fc-epsilon receptor I signaling in mast cells
NCI : PDGFR-beta signaling pathway
NCI : S1P1 pathway
NCI : S1P3 pathway
NCI : Sphingosine 1-phosphate (S1P) pathway
Reactome : Class A/1 (Rhodopsin-like receptors)
Reactome : G alpha (i) signalling events
Reactome : GPCR downstream signaling
Reactome : GPCR ligand binding
Reactome : Lysosphingolipid and LPA receptors
Reactome : Signal Transduction
Reactome : Signaling by GPCR
WikiPathway : GPCRs, Other
WikiPathway : Signal Transduction of S1P Receptor
WikiPathway : Small Ligand GPCRs

Protein

UniProt : P21453
HPRD : 03578

Clone

Cloning Information : 131092
HIP Master Clone ID : 107249
Original Clone ID : FLH131092.01X

Organism


TAX_ID : 9606
Species Specific ID: 1901

Genome

Chromosome : 1
Map Location : 1p21
Ensembl : ENSG00000170989

Reagents

Labome : S1PR1-antibody