DNASU Plasmid Repository • 480.965.5697 | Email

CALM1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CALM1
Gene Name:  calmodulin 1 (phosphorylase kinase, delta)
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH023247.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00001861

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 450nts         Open reading frame : 1 to 450
Reference Sequence Alignment

ATGGCTGATCAGCTGACCGAAGAACAGATTGCTGAATTCAAGGAAGCCTTCTCCCTATTT
GATAAAGATGGCGATGGCACCATCACAACAAAGGAACTTGGAACTGTCATGAGGTCACTG
GGTCAGAACCCAACAGAAGCTGAATTGCAGGATATGATCAATGAAGTGGATGCTGATGGT
AATGGCACCATTGACTTCCCCGAATTTTTGACTATGATGGCTAGAAAAATGAAAGATACA
GATAGTGAAGAAGAAATCCGTGAGGCATTCCGAGTCTTTGACAAGGATGGCAATGGTTAT
ATCAGTGCAGCAGAACTACGTCACGTCATGACAAACTTAGGAGAAAAACTAACAGATGAA
GAAGTAGATGAAATGATCAGAGAAGCAGATATTGATGGAGACGGACAAGTCAACTATGAA
GAATTCGTACAGATGATGACTGCAAAATAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 641
Start on reference sequence 192
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CALM1
Symbol Nomenclature : CALM1
SYNONYM : CALML2; CAMI; CPVT4; DD132; PHKD; caM
Designation : calmodulin|phosphorylase kinase, delta subunit|prepro-calmodulin 1
Full Nomenclature : calmodulin 1 (phosphorylase kinase, delta)
GENEID : 801
GI : 61359448
GenBank Accession : AY888778
HGNC : 1442
MIM : 114180
Vega : OTTHUMG00000171044
Target GenBank: BC000454

 

Reference Sequence Alignment

  

HsCD00001861      ATGGCTGATCAGCTGACCGAAGAACAGATTGCTGAATTCAAGGAAGCCTTCTCCCTATTT
NM_001743.4       ATGGCTGACCAACTGACTGAAGAGCAGATTGCAGAATTCAAAGAAGCTTTTTCACTATTT
NM_006888.4       ATGGCTGATCAGCTGACCGAAGAACAGATTGCTGAATTCAAGGAAGCCTTCTCCCTATTT
NM_005184.2       ATGGCTGACCAGCTGACTGAGGAGCAGATTGCAGAGTTCAAGGAGGCCTTCTCCCTCTTT
                  ******** **.***** **.**.********:**.*****.**.** ** **.**.***

HsCD00001861      GATAAAGATGGCGATGGCACCATCACAACAAAGGAACTTGGAACTGTCATGAGGTCACTG
NM_001743.4       GACAAAGATGGTGATGGAACTATAACAACAAAGGAATTGGGAACTGTAATGAGATCTCTT
NM_006888.4       GATAAAGATGGCGATGGCACCATCACAACAAAGGAACTTGGAACTGTCATGAGGTCACTG
NM_005184.2       GACAAGGATGGAGATGGCACTATCACCACCAAGGAGTTGGGGACAGTGATGAGATCCCTG
                  ** **.***** *****.** **.**.**.*****. * **.**:** *****.** ** 

HsCD00001861      GGTCAGAACCCAACAGAAGCTGAATTGCAGGATATGATCAATGAAGTGGATGCTGATGGT
NM_001743.4       GGGCAGAATCCCACAGAAGCAGAGTTACAGGACATGATTAATGAAGTAGATGCTGATGGT
NM_006888.4       GGTCAGAACCCAACAGAAGCTGAATTGCAGGATATGATCAATGAAGTGGATGCTGATGGT
NM_005184.2       GGACAGAACCCCACTGAAGCAGAGCTGCAGGATATGATCAATGAGGTGGATGCAGATGGG
                  ** ***** **.**:*****:**. *.***** ***** *****.**.*****:***** 

HsCD00001861      AATGGCACCATTGACTTCCCCGAATTTTTGACTATGATGGCTAGAAAAATGAAAGATACA
NM_001743.4       AATGGCACAATTGACTTCCCTGAATTTCTGACAATGATGGCAAGAAAAATGAAAGACACA
NM_006888.4       AATGGCACCATTGACTTCCCCGAATTTTTGACTATGATGGCTAGAAAAATGAAAGATACA
NM_005184.2       AACGGGACCATTGACTTCCCGGAGTTCCTGACCATGATGGCCAGAAAGATGAAGGACACA
                  ** ** **.*********** **.**  **** ******** *****.*****.** ***

HsCD00001861      GATAGTGAAGAAGAAATCCGTGAGGCATTCCGAGTCTTTGACAAGGATGGCAATGGTTAT
NM_001743.4       GACAGTGAAGAAGAAATTAGAGAAGCATTCCGTGTGTTTGATAAGGATGGCAATGGCTAT
NM_006888.4       GATAGTGAAGAAGAAATCCGTGAGGCATTCCGAGTCTTTGACAAGGATGGCAATGGTTAT
NM_005184.2       GACAGTGAGGAGGAGATCCGAGAGGCGTTCCGTGTCTTTGACAAGGATGGGAATGGCTAC
                  ** *****.**.**.** .*:**.**.*****:** ***** ******** ***** ** 

HsCD00001861      ATCAGTGCAGCAGAACTACGTCACGTCATGACAAACTTAGGAGAAAAACTAACAGATGAA
NM_001743.4       ATTAGTGCTGCAGAACTTCGCCATGTGATGACAAACCTTGGAGAGAAGTTAACAGATGAA
NM_006888.4       ATCAGTGCAGCAGAACTACGTCACGTCATGACAAACTTAGGAGAAAAACTAACAGATGAA
NM_005184.2       ATCAGCGCCGCAGAGCTGCGTCACGTAATGACGAACCTGGGGGAGAAGCTGACCGATGAG
                  ** ** ** *****.** ** ** ** *****.*** * **.**.**. *.**.*****.

HsCD00001861      GAAGTAGATGAAATGATCAGAGAAGCAGATATTGATGGAGACGGACAAGTCAACTATGAA
NM_001743.4       GAAGTTGATGAAATGATCAGGGAAGCAGATATTGATGGTGATGGTCAAGTAAACTATGAA
NM_006888.4       GAAGTAGATGAAATGATCAGAGAAGCAGATATTGATGGAGACGGACAAGTCAACTATGAA
NM_005184.2       GAGGTGGATGAGATGATCAGGGAGGCTGACATCGATGGAGATGGCCAGGTCAATTATGAA
                  **.** *****.********.**.**:** ** *****:** ** **.**.** ******

HsCD00001861      GAATTCGTACAGATGATGACTGCAAAATAG
NM_001743.4       GAGTTTGTACAAATGATGACAGCAAAGTGA
NM_006888.4       GAATTCGTACAGATGATGACTGCAAAATGA
NM_005184.2       GAGTTTGTACAGATGATGACTGCAAAGTGA
                  **.** *****.********:*****.*..

Pathways

Reactome : Activation of Ca-permeable Kainate Receptor
Reactome : Activation of CaMK IV
Reactome : Activation of Kainate Receptors upon glutamate binding
Reactome : Activation of NMDA receptor upon glutamate binding and postsynaptic events
Reactome : Adaptive Immune System
Reactome : Antigen activates B Cell Receptor (BCR) leading to generation of second messengers
Reactome : CREB phosphorylation through the activation of CaMKII
Reactome : CREB phosphorylation through the activation of CaMKK
Reactome : CREB phosphorylation through the activation of Ras
Reactome : Ca-dependent events
Reactome : Ca2+ pathway
Reactome : CaM pathway
Reactome : CaMK IV-mediated phosphorylation of CREB
Reactome : Calmodulin induced events
Reactome : Cam-PDE 1 activation
Reactome : DAG and IP3 signaling
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : DARPP-32 events
Reactome : Disease
Reactome : Diseases associated with visual transduction
Reactome : Downstream signal transduction
Reactome : Downstream signaling of activated FGFR
Reactome : EGFR interacts with phospholipase C-gamma
Reactome : FCERI mediated Ca+2 mobilization
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : G-protein mediated events
Reactome : Glucose metabolism
Reactome : Glycogen breakdown (glycogenolysis)
Reactome : Glycogen storage diseases
Reactome : Hemostasis
Reactome : Immune System
Reactome : Inactivation, recovery and regulation of the phototransduction cascade
Reactome : Innate Immune System
Reactome : Inositol phosphate metabolism
Reactome : Ionotropic activity of Kainate Receptors
Reactome : Membrane Trafficking
Reactome : Metabolism
Reactome : Metabolism of carbohydrates
Reactome : Metabolism of nitric oxide
Reactome : Mitochondrial biogenesis
Reactome : Muscle contraction
Reactome : Myoclonic epilepsy of Lafora
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Opioid Signalling
Reactome : Organelle biogenesis and maintenance
Reactome : PLC beta mediated events
Reactome : PLC-gamma1 signalling
Reactome : PLCG1 events in ERBB2 signaling
Reactome : Phospholipase C-mediated cascade
Reactome : Platelet activation, signaling and aggregation
Reactome : Platelet degranulation
Reactome : Post NMDA receptor activation events
Reactome : Ras activation uopn Ca2+ infux through NMDA receptor
Reactome : Response to elevated platelet cytosolic Ca2+
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by PDGF
Reactome : Signaling by Wnt
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : Smooth Muscle Contraction
Reactome : Synthesis of IP3 and IP4 in the cytosol
Reactome : Tetrahydrobiopterin (BH4) synthesis, recycling, salvage and regulation
Reactome : The phototransduction cascade
Reactome : Transcriptional activation of mitochondrial biogenesis
Reactome : Translocation of GLUT4 to the plasma membrane
Reactome : Transmission across Chemical Synapses
Reactome : Visual phototransduction
Reactome : beta-catenin independent WNT signaling
Reactome : eNOS activation
Reactome : eNOS activation and regulation
WikiPathway : Alzheimers Disease
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : Endochondral Ossification
WikiPathway : G Protein Signaling Pathways
WikiPathway : G13 Signaling Pathway
WikiPathway : Glycogen Metabolism
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Myometrial Relaxation and Contraction Pathways
WikiPathway : Physiological and Pathological Hypertrophy of the Heart

Protein

SMART domain : EFh : EF-hand, calcium binding motif
UniProt : B4DJ51
UniProt : P62158
HPRD : 00241

Clone

Cloning Information : 23247
HIP Master Clone ID : 53623
Original Clone ID : FLH023247.01X

Organism


TAX_ID : 9606
Species Specific ID: 801

Genome

Chromosome : 14
Map Location : 14q32.11
Ensembl : ENSG00000198668

Reagents

Labome : calmodulin-antibody