DNASU Plasmid Repository • 480.965.5697 | Email

PCNA (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PCNA
Gene Name:  proliferating cell nuclear antigen
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH117197.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00001876

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 786nts         Open reading frame : 1 to 786
Reference Sequence Alignment

ATGTTCGAGGCGCGCCTGGTCCAGGGCTCCATCCTCAAGAAGGTGTTGGAGGCACTCAAG
GACCTCATCAACGAGGCCTGCTGGGATATTAGCTCCAGCGGTGTAAACCTGCAGAGCATG
GACTCGTCCCACGTCTCTTTGGTGCAGCTCACCCTGCGGTCTGAGGGCTTCGACACCTAC
CGCTGCGACCGCAACCTGGCCATGGGCGTGAACCTCACCAGTATGTCCAAAATACTAAAA
TGCGCCGGCAATGAAGATATCATTACACTAAGGGCCGAAGATAACGCGGATACCTTGGCG
CTAGTATTTGAAGCACCAAACCAGGAGAAAGTTTCAGACTATGAAATGAAGTTGATGGAT
TTAGATGTTGAACAACTTGGAATTCCAGAACAGGAGTACAGCTGTGTAGTAAAGATGCCT
TCTGGTGAATTTGCACGTATATGCCGAGATCTCAGCCATATTGGAGATGCTGTTGTAATT
TCCTGTGCAAAAGACGGAGTGAAATTTTCTGCAAGTGGAGAACTTGGAAATGGAAACATT
AAATTGTCACAGACAAGTAATGTCGATAAAGAGGAGGAAGCTGTTACCATAGAGATGAAT
GAACCAGTTCAACTAACTTTTGCACTGAGGTACCTGAACTTCTTTACAAAAGCCACTCCA
CTCTCTTCAACGGTGACACTCAGTATGTCTGCAGATGTACCCCTTGTTGTAGAGTATAAA
ATTGCGGATATGGGACACTTAAAATACTACTTGGCTCCCAAGATCGAGGATGAAGAAGGA
TCTTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 940
Start on reference sequence 155
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PCNA
Symbol Nomenclature : PCNA
Designation : DNA polymerase delta auxiliary protein|cyclin
Full Nomenclature : proliferating cell nuclear antigen
GENEID : 5111
GI : 61359491
GenBank Accession : AY888784
HGNC : 8729
MIM : 176740
Vega : OTTHUMG00000031798
Target GenBank: BC000491

 

Reference Sequence Alignment

  

HsCD00001876      ATGTTCGAGGCGCGCCTGGTCCAGGGCTCCATCCTCAAGAAGGTGTTGGAGGCACTCAAG
NM_182649.1       ATGTTCGAGGCGCGCCTGGTCCAGGGCTCCATCCTCAAGAAGGTGTTGGAGGCACTCAAG
NM_002592.2       ATGTTCGAGGCGCGCCTGGTCCAGGGCTCCATCCTCAAGAAGGTGTTGGAGGCACTCAAG
                  ************************************************************

HsCD00001876      GACCTCATCAACGAGGCCTGCTGGGATATTAGCTCCAGCGGTGTAAACCTGCAGAGCATG
NM_182649.1       GACCTCATCAACGAGGCCTGCTGGGATATTAGCTCCAGCGGTGTAAACCTGCAGAGCATG
NM_002592.2       GACCTCATCAACGAGGCCTGCTGGGATATTAGCTCCAGCGGTGTAAACCTGCAGAGCATG
                  ************************************************************

HsCD00001876      GACTCGTCCCACGTCTCTTTGGTGCAGCTCACCCTGCGGTCTGAGGGCTTCGACACCTAC
NM_182649.1       GACTCGTCCCACGTCTCTTTGGTGCAGCTCACCCTGCGGTCTGAGGGCTTCGACACCTAC
NM_002592.2       GACTCGTCCCACGTCTCTTTGGTGCAGCTCACCCTGCGGTCTGAGGGCTTCGACACCTAC
                  ************************************************************

HsCD00001876      CGCTGCGACCGCAACCTGGCCATGGGCGTGAACCTCACCAGTATGTCCAAAATACTAAAA
NM_182649.1       CGCTGCGACCGCAACCTGGCCATGGGCGTGAACCTCACCAGTATGTCCAAAATACTAAAA
NM_002592.2       CGCTGCGACCGCAACCTGGCCATGGGCGTGAACCTCACCAGTATGTCCAAAATACTAAAA
                  ************************************************************

HsCD00001876      TGCGCCGGCAATGAAGATATCATTACACTAAGGGCCGAAGATAACGCGGATACCTTGGCG
NM_182649.1       TGCGCCGGCAATGAAGATATCATTACACTAAGGGCCGAAGATAACGCGGATACCTTGGCG
NM_002592.2       TGCGCCGGCAATGAAGATATCATTACACTAAGGGCCGAAGATAACGCGGATACCTTGGCG
                  ************************************************************

HsCD00001876      CTAGTATTTGAAGCACCAAACCAGGAGAAAGTTTCAGACTATGAAATGAAGTTGATGGAT
NM_182649.1       CTAGTATTTGAAGCACCAAACCAGGAGAAAGTTTCAGACTATGAAATGAAGTTGATGGAT
NM_002592.2       CTAGTATTTGAAGCACCAAACCAGGAGAAAGTTTCAGACTATGAAATGAAGTTGATGGAT
                  ************************************************************

HsCD00001876      TTAGATGTTGAACAACTTGGAATTCCAGAACAGGAGTACAGCTGTGTAGTAAAGATGCCT
NM_182649.1       TTAGATGTTGAACAACTTGGAATTCCAGAACAGGAGTACAGCTGTGTAGTAAAGATGCCT
NM_002592.2       TTAGATGTTGAACAACTTGGAATTCCAGAACAGGAGTACAGCTGTGTAGTAAAGATGCCT
                  ************************************************************

HsCD00001876      TCTGGTGAATTTGCACGTATATGCCGAGATCTCAGCCATATTGGAGATGCTGTTGTAATT
NM_182649.1       TCTGGTGAATTTGCACGTATATGCCGAGATCTCAGCCATATTGGAGATGCTGTTGTAATT
NM_002592.2       TCTGGTGAATTTGCACGTATATGCCGAGATCTCAGCCATATTGGAGATGCTGTTGTAATT
                  ************************************************************

HsCD00001876      TCCTGTGCAAAAGACGGAGTGAAATTTTCTGCAAGTGGAGAACTTGGAAATGGAAACATT
NM_182649.1       TCCTGTGCAAAAGACGGAGTGAAATTTTCTGCAAGTGGAGAACTTGGAAATGGAAACATT
NM_002592.2       TCCTGTGCAAAAGACGGAGTGAAATTTTCTGCAAGTGGAGAACTTGGAAATGGAAACATT
                  ************************************************************

HsCD00001876      AAATTGTCACAGACAAGTAATGTCGATAAAGAGGAGGAAGCTGTTACCATAGAGATGAAT
NM_182649.1       AAATTGTCACAGACAAGTAATGTCGATAAAGAGGAGGAAGCTGTTACCATAGAGATGAAT
NM_002592.2       AAATTGTCACAGACAAGTAATGTCGATAAAGAGGAGGAAGCTGTTACCATAGAGATGAAT
                  ************************************************************

HsCD00001876      GAACCAGTTCAACTAACTTTTGCACTGAGGTACCTGAACTTCTTTACAAAAGCCACTCCA
NM_182649.1       GAACCAGTTCAACTAACTTTTGCACTGAGGTACCTGAACTTCTTTACAAAAGCCACTCCA
NM_002592.2       GAACCAGTTCAACTAACTTTTGCACTGAGGTACCTGAACTTCTTTACAAAAGCCACTCCA
                  ************************************************************

HsCD00001876      CTCTCTTCAACGGTGACACTCAGTATGTCTGCAGATGTACCCCTTGTTGTAGAGTATAAA
NM_182649.1       CTCTCTTCAACGGTGACACTCAGTATGTCTGCAGATGTACCCCTTGTTGTAGAGTATAAA
NM_002592.2       CTCTCTTCAACGGTGACACTCAGTATGTCTGCAGATGTACCCCTTGTTGTAGAGTATAAA
                  ************************************************************

HsCD00001876      ATTGCGGATATGGGACACTTAAAATACTACTTGGCTCCCAAGATCGAGGATGAAGAAGGA
NM_182649.1       ATTGCGGATATGGGACACTTAAAATACTACTTGGCTCCCAAGATCGAGGATGAAGAAGGA
NM_002592.2       ATTGCGGATATGGGACACTTAAAATACTACTTGGCTCCCAAGATCGAGGATGAAGAAGGA
                  ************************************************************

HsCD00001876      TCTTAG
NM_182649.1       TCTTAG
NM_002592.2       TCTTAG
                  ******

Pathways

NCI : BARD1 signaling events
NCI : Direct p53 effectors
NCI : Validated nuclear estrogen receptor alpha network
Panther : DNA replication
Reactome : Base Excision Repair
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Chromosome Maintenance
Reactome : DNA Repair
Reactome : DNA Replication
Reactome : DNA strand elongation
Reactome : E2F mediated regulation of DNA replication
Reactome : Extension of Telomeres
Reactome : G0 and Early G1
Reactome : G1/S Transition
Reactome : G1/S-Specific Transcription
Reactome : Gap-filling DNA repair synthesis and ligation in GG-NER
Reactome : Gap-filling DNA repair synthesis and ligation in TC-NER
Reactome : Global Genomic NER (GG-NER)
Reactome : Lagging Strand Synthesis
Reactome : Leading Strand Synthesis
Reactome : Mitotic G1-G1/S phases
Reactome : Nucleotide Excision Repair
Reactome : Polymerase switching
Reactome : Polymerase switching on the C-strand of the telomere
Reactome : Processive synthesis on the C-strand of the telomere
Reactome : Processive synthesis on the lagging strand
Reactome : Removal of DNA patch containing abasic residue
Reactome : Removal of the Flap Intermediate
Reactome : Removal of the Flap Intermediate from the C-strand
Reactome : Repair synthesis for gap-filling by DNA polymerase in TC-NER
Reactome : Repair synthesis of patch ~27-30 bases long by DNA polymerase
Reactome : Resolution of AP sites via the multiple-nucleotide patch replacement pathway
Reactome : Resolution of Abasic Sites (AP sites)
Reactome : S Phase
Reactome : Synthesis of DNA
Reactome : Telomere C-strand (Lagging Strand) Synthesis
Reactome : Telomere Maintenance
Reactome : Transcription-coupled NER (TC-NER)
WikiPathway : Cell cycle
WikiPathway : DNA Replication
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : G1 to S cell cycle control
WikiPathway : Mismatch repair
WikiPathway : Nifedipine Activity

Protein

UniProt : P12004
HPRD : 01456

Clone

Cloning Information : 117197
HIP Master Clone ID : 93043
Original Clone ID : FLH117197.01X

Organism


TAX_ID : 9606
Species Specific ID: 5111

Genome

Chromosome : 20
Map Location : 20pter-p12
Ensembl : ENSG00000132646

Reagents

Labome : PCNA-antibody