DNASU Plasmid Repository • 480.965.5697 | Email

LCP2 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  LCP2
Gene Name:  lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH015460.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00001910

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1602nts         Open reading frame : 1 to 1602
Reference Sequence Alignment

ATGGCACTGAGGAATGTGCCCTTTCGCTCAGAGGTCCTGGGCTGGGACCCCGACAGCCTT
GCTGACTATTTCAAGAAGCTCAACTATAAGGACTGTGAGAAGGCAGTGAAGAAGTACCAC
ATCGATGGGGCTCGCTTCTTGAACCTGACAGAAAATGACATCCAGAAGTTCCCCAAGCTC
CGGGTGCCGATTCTCAGTAAGTTAAGTCAGGAAATCAACAAGAACGAAGAGAGGAGGAGC
ATCTTCACACGCAAACCCCAAGTCCCGCGGTTTCCTGAAGAGACAGAAAGCCACGAAGAG
GACAATGGGGGCTGGTCGTCCTTTGAAGAAGACGATTATGAAAGTCCCAATGATGACCAG
GATGGGGAGGATGATGGAGACTATGAGTCCCCCAATGAGGAGGAAGAGGCACCCGTGGAA
GATGACGCGGATTATGAGCCGCCACCCTCCAATGACGAGGAAGCTCTGCAGAACTCCATC
CTGCCTGCCAAGCCTTTCCCCAACTCCAACTCCATGTACATCGACCGGCCCCCCTCTGGG
AAAACCCCCCAGCAGCCTCCTGTGCCCCCCCAGAGACCGATGGCCGCCCTCCCGCCCCCA
CCAGCCGGCCGGAATCACTCGCCACTGCCCCCACCCCAGACCAACCACGAAGAACCCAGC
AGAAGCAGAAACCACAAAACGGCAAAGCTCCCTGCTCCTTCAATAGACAGAAGCACGAAA
CCTCCCCTAGATCGTTCATTAGCTCCGTTTGATAGAGAACCCTTCACACTAGGAAAGAAA
CCACCATTTTCTGACAAGCCCTCGATTCCAGCGGGAAGGTCACTCGGGGAGCATTTACCC
AAGATTCAAAAGCCTCCTTTACCACCGACCACGGAAAGACATGAAAGGAGCAGCCCCCTG
CCAGGGAAGAAGCCACCTGTGCCAAAGCATGGATGGGGACCAGACAGAAGAGAGAATGAT
GAAGATGATGTGCATCAGAGACCTTTGCCCCAGCCAGCACTACTTCCTATGAGCTCCAAC
ACTTTCCCTTCAAGATCTACTAAGCCAAGTCCCATGAACCCTCTCCCATCCTCTCACATG
CCTGGAGCATTCTCAGAAAGTAACAGCAGTTTTCCACAGAGTGCCTCCCTGCCACCATAC
TTCTCTCAAGGCCCTAGCAACAGACCACCTATCAGAGCCGAAGGCAGAAACTTCCCCTTG
CCACTTCCAAACAAACCTCGGCCCCCATCCCCCGCGGAGGAAGAGAATTCATTAAATGAA
GAGTGGTACGTTTCTTATATTACCCGACCAGAGGCAGAAGCTGCTCTTAGAAAGATAAAC
CAGGATGGCACATTTCTGGTCAGAGACAGCTCTAAAAAAACAACAACCAATCCATATGTC
CTCATGGTGTTGTACAAAGATAAAGTTTACAACATCCAGATCCGTTATCAGAAGGAAAGT
CAAGTTTACTTGTTGGGAACTGGACTCCGAGGGAAAGAGGACTTTCTGTCTGTGTCAGAT
ATTATTGACTACTTCAGGAAAATGCCACTTCTGCTCATTGATGGGAAAAACCGAGGTTCC
AGATACCAGTGCACATTAACGCATGCTGCAGGGTACCCATAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1746
Start on reference sequence 145
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : LCP2
Symbol Nomenclature : LCP2
SYNONYM : SLP-76; SLP76
Designation : 76 kDa tyrosine phosphoprotein|SH2 domain-containing leukocyte protein of 76 kDa|SH2 domain-containing leukocyte protein of 76kD|SLP-76 tyrosine phosphoprotein|lymphocyte cytosolic protein 2
Full Nomenclature : lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)
GENEID : 3937
GI : 61359570
GenBank Accession : AY888795
HGNC : 6529
MIM : 601603
Target GenBank: BC016618

 

Reference Sequence Alignment

  

HsCD00001910      ATGGCACTGAGGAATGTGCCCTTTCGCTCAGAGGTCCTGGGCTGGGACCCCGACAGCCTT
NM_005565.3       ATGGCACTGAGGAATGTGCCCTTTCGCTCAGAGGTCCTGGGCTGGGACCCCGACAGCCTT
                  ************************************************************

HsCD00001910      GCTGACTATTTCAAGAAGCTCAACTATAAGGACTGTGAGAAGGCAGTGAAGAAGTACCAC
NM_005565.3       GCTGACTATTTCAAGAAGCTCAACTATAAGGACTGTGAGAAGGCAGTGAAGAAGTACCAC
                  ************************************************************

HsCD00001910      ATCGATGGGGCTCGCTTCTTGAACCTGACAGAAAATGACATCCAGAAGTTCCCCAAGCTC
NM_005565.3       ATCGATGGGGCTCGCTTCTTGAACCTGACAGAAAATGACATCCAGAAGTTCCCCAAGCTC
                  ************************************************************

HsCD00001910      CGGGTGCCGATTCTCAGTAAGTTAAGTCAGGAAATCAACAAGAACGAAGAGAGGAGGAGC
NM_005565.3       CGGGTGCCGATTCTCAGTAAGTTAAGTCAGGAAATCAACAAGAACGAAGAGAGGAGGAGC
                  ************************************************************

HsCD00001910      ATCTTCACACGCAAACCCCAAGTCCCGCGGTTTCCTGAAGAGACAGAAAGCCACGAAGAG
NM_005565.3       ATCTTCACACGCAAACCCCAAGTCCCGCGGTTTCCTGAAGAGACAGAAAGCCACGAAGAG
                  ************************************************************

HsCD00001910      GACAATGGGGGCTGGTCGTCCTTTGAAGAAGACGATTATGAAAGTCCCAATGATGACCAG
NM_005565.3       GACAATGGGGGCTGGTCGTCCTTTGAAGAAGACGATTATGAAAGTCCCAATGATGACCAG
                  ************************************************************

HsCD00001910      GATGGGGAGGATGATGGAGACTATGAGTCCCCCAATGAGGAGGAAGAGGCACCCGTGGAA
NM_005565.3       GATGGGGAGGATGATGGAGACTATGAGTCCCCCAATGAGGAGGAAGAGGCACCCGTGGAA
                  ************************************************************

HsCD00001910      GATGACGCGGATTATGAGCCGCCACCCTCCAATGACGAGGAAGCTCTGCAGAACTCCATC
NM_005565.3       GATGACGCGGATTATGAGCCGCCACCCTCCAATGACGAGGAAGCTCTGCAGAACTCCATC
                  ************************************************************

HsCD00001910      CTGCCTGCCAAGCCTTTCCCCAACTCCAACTCCATGTACATCGACCGGCCCCCCTCTGGG
NM_005565.3       CTGCCTGCCAAGCCTTTCCCCAACTCCAACTCCATGTACATCGACCGGCCCCCCTCTGGG
                  ************************************************************

HsCD00001910      AAAACCCCCCAGCAGCCTCCTGTGCCCCCCCAGAGACCGATGGCCGCCCTCCCGCCCCCA
NM_005565.3       AAAACCCCCCAGCAGCCTCCTGTGCCCCCCCAGAGACCGATGGCCGCCCTCCCGCCCCCA
                  ************************************************************

HsCD00001910      CCAGCCGGCCGGAATCACTCGCCACTGCCCCCACCCCAGACCAACCACGAAGAACCCAGC
NM_005565.3       CCAGCCGGCCGGAATCACTCGCCACTGCCCCCACCCCAGACCAACCACGAAGAACCCAGC
                  ************************************************************

HsCD00001910      AGAAGCAGAAACCACAAAACGGCAAAGCTCCCTGCTCCTTCAATAGACAGAAGCACGAAA
NM_005565.3       AGAAGCAGAAACCACAAAACGGCAAAGCTCCCTGCTCCTTCAATAGACAGAAGCACGAAA
                  ************************************************************

HsCD00001910      CCTCCCCTAGATCGTTCATTAGCTCCGTTTGATAGAGAACCCTTCACACTAGGAAAGAAA
NM_005565.3       CCTCCCCTAGATCGTTCATTAGCTCCGTTTGATAGAGAACCCTTCACACTAGGAAAGAAA
                  ************************************************************

HsCD00001910      CCACCATTTTCTGACAAGCCCTCGATTCCAGCGGGAAGGTCACTCGGGGAGCATTTACCC
NM_005565.3       CCACCATTTTCTGACAAGCCCTCGATTCCAGCGGGAAGGTCACTCGGGGAGCATTTACCC
                  ************************************************************

HsCD00001910      AAGATTCAAAAGCCTCCTTTACCACCGACCACGGAAAGACATGAAAGGAGCAGCCCCCTG
NM_005565.3       AAGATTCAAAAGCCTCCTTTACCACCGACCACGGAAAGACATGAAAGGAGCAGCCCCCTG
                  ************************************************************

HsCD00001910      CCAGGGAAGAAGCCACCTGTGCCAAAGCATGGATGGGGACCAGACAGAAGAGAGAATGAT
NM_005565.3       CCAGGGAAGAAGCCACCTGTGCCAAAGCATGGATGGGGACCAGACAGAAGAGAGAATGAT
                  ************************************************************

HsCD00001910      GAAGATGATGTGCATCAGAGACCTTTGCCCCAGCCAGCACTACTTCCTATGAGCTCCAAC
NM_005565.3       GAAGATGATGTGCATCAGAGACCTTTGCCCCAGCCAGCACTACTTCCTATGAGCTCCAAC
                  ************************************************************

HsCD00001910      ACTTTCCCTTCAAGATCTACTAAGCCAAGTCCCATGAACCCTCTCCCATCCTCTCACATG
NM_005565.3       ACTTTCCCTTCAAGATCTACTAAGCCAAGTCCCATGAACCCTCTCCCATCCTCTCACATG
                  ************************************************************

HsCD00001910      CCTGGAGCATTCTCAGAAAGTAACAGCAGTTTTCCACAGAGTGCCTCCCTGCCACCATAC
NM_005565.3       CCTGGAGCATTCTCAGAAAGTAACAGCAGTTTTCCACAGAGTGCCTCCCTGCCACCATAC
                  ************************************************************

HsCD00001910      TTCTCTCAAGGCCCTAGCAACAGACCACCTATCAGAGCCGAAGGCAGAAACTTCCCCTTG
NM_005565.3       TTCTCTCAAGGCCCTAGCAACAGACCACCTATCAGAGCCGAAGGCAGAAACTTCCCCTTG
                  ************************************************************

HsCD00001910      CCACTTCCAAACAAACCTCGGCCCCCATCCCCCGCGGAGGAAGAGAATTCATTAAATGAA
NM_005565.3       CCACTTCCAAACAAACCTCGGCCCCCATCCCCCGCGGAGGAAGAGAATTCATTAAATGAA
                  ************************************************************

HsCD00001910      GAGTGGTACGTTTCTTATATTACCCGACCAGAGGCAGAAGCTGCTCTTAGAAAGATAAAC
NM_005565.3       GAGTGGTACGTTTCTTATATTACCCGACCAGAGGCAGAAGCTGCTCTTAGAAAGATAAAC
                  ************************************************************

HsCD00001910      CAGGATGGCACATTTCTGGTCAGAGACAGCTCTAAAAAAACAACAACCAATCCATATGTC
NM_005565.3       CAGGATGGCACATTTCTGGTCAGAGACAGCTCTAAAAAAACAACAACCAATCCATATGTC
                  ************************************************************

HsCD00001910      CTCATGGTGTTGTACAAAGATAAAGTTTACAACATCCAGATCCGTTATCAGAAGGAAAGT
NM_005565.3       CTCATGGTGTTGTACAAAGATAAAGTTTACAACATCCAGATCCGTTATCAGAAGGAAAGT
                  ************************************************************

HsCD00001910      CAAGTTTACTTGTTGGGAACTGGACTCCGAGGGAAAGAGGACTTTCTGTCTGTGTCAGAT
NM_005565.3       CAAGTTTACTTGTTGGGAACTGGACTCCGAGGGAAAGAGGACTTTCTGTCTGTGTCAGAT
                  ************************************************************

HsCD00001910      ATTATTGACTACTTCAGGAAAATGCCACTTCTGCTCATTGATGGGAAAAACCGAGGTTCC
NM_005565.3       ATTATTGACTACTTCAGGAAAATGCCACTTCTGCTCATTGATGGGAAAAACCGAGGTTCC
                  ************************************************************

HsCD00001910      AGATACCAGTGCACATTAACGCATGCTGCAGGGTACCCATAG
NM_005565.3       AGATACCAGTGCACATTAACGCATGCTGCAGGGTACCCATAG
                  ******************************************

Pathways

NCI : Fc-epsilon receptor I signaling in mast cells
NCI : JNK signaling in the CD4+ TCR pathway
NCI : TCR signaling in naïve CD4+ T cells
NCI : TCR signaling in naïve CD8+ T cells
Panther : T cell activation
Reactome : Adaptive Immune System
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : FCERI mediated Ca+2 mobilization
Reactome : FCERI mediated MAPK activation
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GPVI-mediated activation cascade
Reactome : Generation of second messenger molecules
Reactome : Hemostasis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Platelet activation, signaling and aggregation
Reactome : TCR signaling

Protein

SMART domain : SH2 : Src homology 2 domains
SMART domain : SAM : Sterile alpha motif.
UniProt : Q13094
HPRD : 03362

Clone

Cloning Information : 15460
HIP Master Clone ID : 29659
Original Clone ID : FLH015460.01X

Organism


TAX_ID : 9606
Species Specific ID: 3937

Genome

Chromosome : 5
Map Location : 5q35.1

Reagents

Labome : SLP-76-antibody