DNASU Plasmid Repository • 480.965.5697 | Email

ATP6V1A1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ATP6V1A
Gene Name:  ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH013978.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00001924

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1854nts        
Open reading frame : 1 to 1854
Reference Sequence Alignment

ATGGATTTTTCCAAGCTACCCAAAATACTCGATGAAGATAAAGAAAGCACATTTGGTTAT
GTGCATGGGGTCTCAGGACCTGTGGTTACAGCCTGTGACATGGCGGGTGCAGCCATGTAT
GAGCTGGTGAGAGTGGGCCACAGCGAATTGGTTGGAGAGATTATTCGATTGGAGGGTGAC
ATGGCTACTATTCAGGTGTATGAAGAAACTTCTGGTGTGTCTGTTGGAGATCCTGTACTT
CGCACTGGTAAACCCCTCTCTGTAGAGCTTGGTCCTGGCATTATGGGAGCCATTTTTGAT
GGTATTCAAAGACCTTTGTCGGATATCAGCAGTCAGACCCAAAGCATCTACATCCCCAGA
GGAGTAAACGTGTCTGCTCTTAGCAGAGATATCAAATGGGACTTTACACCTTGCAAAAAC
CTACGGGTTGGTAGTCATATCACTGGCGGAGACATTTATGGAATTGTCAGTGAGAACTCG
CTTATCAAACACAAAATCATGTTACCCCCACGAAACAGAGGAACTGTAACTTACATTGCT
CCACCTGGGAATTATGATACCTCTGATGTTGTCTTGGAGCTTGAATTTGAAGGTGTAAAG
GAGAAGTTCACCATGGTGCAAGTATGGCCTGTACGTCAAGTTCGACCTGTCACTGAGAAG
CTGCCAGCCAATCATCCTCTGTTGACTGGCCAGAGAGTCCTTGATGCCCTTTTTCCGTGT
GTCCAGGGAGGAACTACTGCTATCCCTGGAGCCTTTGGCTGTGGAAAGACAGTGATATCA
CAGTCTCTATCCAAGTATTCTAACAGTGATGTAATCATCTATGTAGGATGTGGTGAAAGA
GGAAATGAGATGTCTGAAGTCCTCCGGGACTTCCCAGAGCTCACAATGGAGGTTGATGGT
AAGGTAGAGTCAATTATGAAGAGGACAGCTTTGGTAGCCAATACCTCCAATATGCCTGTT
GCTGCTAGAGAAGCCTCTATTTATACTGGAATCACACTGTCAGAGTACTTCCGTGACATG
GGCTATCATGTCAGTATGATGGCTGACTCTACCTCTAGATGGGCTGAGGCCCTTAGAGAA
ATCTCTGGTCGTTTAGCTGAAATGCCTGCAGATAGTGGATATCCAGCCTATCTTGGTGCC
CGTCTGGCCTCGTTTTATGAACGAGCAGGCAGGGTGAAATGTCTTGGAAATCCTGAAAGA
GAAGGGAGTGTCAGCATTGTAGGAGCAGTTTCTCCACCTGGTGGTGATTTTTCTGATCCA
GTTACATCTGCCACTCTTGGTATCGTTCAGGTGTTCTGGGGCTTAGATAAGAAACTAGCT
CAACGTAAGCATTTCCCCTCTGTCAATTGGCTCATCAGCTACAGCAAGTATATGCGTGCC
TTGGATGAATACTATGACAAACACTTCACAGAGTTCGTTCCTCTGAGGACGAAAGCTAAG
GAAATTCTGCAGGAAGAAGAAGACCTGGCAGAAATTGTACAGCTTGTGGGAAAGGCTTCT
TTGGCAGAAACAGATAAAATCACTCTGGAGGTAGCAAAACTTATCAAAGATGATTTCCTA
CAACAAAATGGATATACTCCTTATGACAGGTTCTGCCCATTCTACAAGACAGTAGGGATG
CTGTCCAACATGATTGCATTTTATGATATGGCTCGTAGAGCTGTTGAAACCACTGCCCAG
AGTGACAATAAAATCACATGGTCCATTATTCGTGAGCACATGGGAGACATCCTCTATAAA
CTTTCCTCCATGAAATTCAAGGATCCACTGAAAGATGGTGAGGCAAAGATCAAAAGCGAC
TATGCACAACTTCTTGAAGACATGCAGAATGCATTCCGTAGCCTTGAAGATTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1910
Start on reference sequence 57
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 9 42
recombination site loxP site loxP recombination site 1015 1048
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ATP6V1A
Symbol Nomenclature : ATP6V1A
SYNONYM : ATP6A1; ATP6V1A1; HO68; VA68; VPP2; Vma1
Designation : ATPase, H+ transporting, lysosomal, subunit A1|H(+)-transporting two-sector ATPase, subunit A|H+-transporting ATPase chain A, vacuolar (VA68 type)|V-ATPase 69 kDa subunit 1|V-ATPase A subunit 1|V-ATPase subunit A|V-type proton ATPase catalytic subunit A|vacuolar ATP synthase catalytic subunit A, ubiquitous isoform|vacuolar ATPase isoform VA68|vacuolar proton pump alpha subunit 1|vacuolar proton pump subunit alpha
Full Nomenclature : ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A
GENEID : 523
GI : 61369693
GenBank Accession : AY891448
HGNC : 851
MIM : 607027
Vega : OTTHUMG00000159295
Target GenBank: BC013138

 

Reference Sequence Alignment

  

HsCD00001924      ATGGATTTTTCCAAGCTACCCAAAATACTCGATGAAGATAAAGAAAGCACATTTGGTTAT
NM_001690.3       ATGGATTTTTCCAAGCTACCCAAAATACTCGATGAAGATAAAGAAAGCACATTTGGTTAT
                  ************************************************************

HsCD00001924      GTGCATGGGGTCTCAGGACCTGTGGTTACAGCCTGTGACATGGCGGGTGCAGCCATGTAT
NM_001690.3       GTGCATGGGGTCTCAGGACCTGTGGTTACAGCCTGTGACATGGCGGGTGCAGCCATGTAT
                  ************************************************************

HsCD00001924      GAGCTGGTGAGAGTGGGCCACAGCGAATTGGTTGGAGAGATTATTCGATTGGAGGGTGAC
NM_001690.3       GAGCTGGTGAGAGTGGGCCACAGCGAATTGGTTGGAGAGATTATTCGATTGGAGGGTGAC
                  ************************************************************

HsCD00001924      ATGGCTACTATTCAGGTGTATGAAGAAACTTCTGGTGTGTCTGTTGGAGATCCTGTACTT
NM_001690.3       ATGGCTACTATTCAGGTGTATGAAGAAACTTCTGGTGTGTCTGTTGGAGATCCTGTACTT
                  ************************************************************

HsCD00001924      CGCACTGGTAAACCCCTCTCTGTAGAGCTTGGTCCTGGCATTATGGGAGCCATTTTTGAT
NM_001690.3       CGCACTGGTAAACCCCTCTCTGTAGAGCTTGGTCCTGGCATTATGGGAGCCATTTTTGAT
                  ************************************************************

HsCD00001924      GGTATTCAAAGACCTTTGTCGGATATCAGCAGTCAGACCCAAAGCATCTACATCCCCAGA
NM_001690.3       GGTATTCAAAGACCTTTGTCGGATATCAGCAGTCAGACCCAAAGCATCTACATCCCCAGA
                  ************************************************************

HsCD00001924      GGAGTAAACGTGTCTGCTCTTAGCAGAGATATCAAATGGGACTTTACACCTTGCAAAAAC
NM_001690.3       GGAGTAAACGTGTCTGCTCTTAGCAGAGATATCAAATGGGACTTTACACCTTGCAAAAAC
                  ************************************************************

HsCD00001924      CTACGGGTTGGTAGTCATATCACTGGCGGAGACATTTATGGAATTGTCAGTGAGAACTCG
NM_001690.3       CTACGGGTTGGTAGTCATATCACTGGCGGAGACATTTATGGAATTGTCAGTGAGAACTCG
                  ************************************************************

HsCD00001924      CTTATCAAACACAAAATCATGTTACCCCCACGAAACAGAGGAACTGTAACTTACATTGCT
NM_001690.3       CTTATCAAACACAAAATCATGTTACCCCCACGAAACAGAGGAACTGTAACTTACATTGCT
                  ************************************************************

HsCD00001924      CCACCTGGGAATTATGATACCTCTGATGTTGTCTTGGAGCTTGAATTTGAAGGTGTAAAG
NM_001690.3       CCACCTGGGAATTATGATACCTCTGATGTTGTCTTGGAGCTTGAATTTGAAGGTGTAAAG
                  ************************************************************

HsCD00001924      GAGAAGTTCACCATGGTGCAAGTATGGCCTGTACGTCAAGTTCGACCTGTCACTGAGAAG
NM_001690.3       GAGAAGTTCACCATGGTGCAAGTATGGCCTGTACGTCAAGTTCGACCTGTCACTGAGAAG
                  ************************************************************

HsCD00001924      CTGCCAGCCAATCATCCTCTGTTGACTGGCCAGAGAGTCCTTGATGCCCTTTTTCCGTGT
NM_001690.3       CTGCCAGCCAATCATCCTCTGTTGACTGGCCAGAGAGTCCTTGATGCCCTTTTTCCGTGT
                  ************************************************************

HsCD00001924      GTCCAGGGAGGAACTACTGCTATCCCTGGAGCCTTTGGCTGTGGAAAGACAGTGATATCA
NM_001690.3       GTCCAGGGAGGAACTACTGCTATCCCTGGAGCCTTTGGCTGTGGAAAGACAGTGATATCA
                  ************************************************************

HsCD00001924      CAGTCTCTATCCAAGTATTCTAACAGTGATGTAATCATCTATGTAGGATGTGGTGAAAGA
NM_001690.3       CAGTCTCTATCCAAGTATTCTAACAGTGATGTAATCATCTATGTAGGATGTGGTGAAAGA
                  ************************************************************

HsCD00001924      GGAAATGAGATGTCTGAAGTCCTCCGGGACTTCCCAGAGCTCACAATGGAGGTTGATGGT
NM_001690.3       GGAAATGAGATGTCTGAAGTCCTCCGGGACTTCCCAGAGCTCACAATGGAGGTTGATGGT
                  ************************************************************

HsCD00001924      AAGGTAGAGTCAATTATGAAGAGGACAGCTTTGGTAGCCAATACCTCCAATATGCCTGTT
NM_001690.3       AAGGTAGAGTCAATTATGAAGAGGACAGCTTTGGTAGCCAATACCTCCAATATGCCTGTT
                  ************************************************************

HsCD00001924      GCTGCTAGAGAAGCCTCTATTTATACTGGAATCACACTGTCAGAGTACTTCCGTGACATG
NM_001690.3       GCTGCTAGAGAAGCCTCTATTTATACTGGAATCACACTGTCAGAGTACTTCCGTGACATG
                  ************************************************************

HsCD00001924      GGCTATCATGTCAGTATGATGGCTGACTCTACCTCTAGATGGGCTGAGGCCCTTAGAGAA
NM_001690.3       GGCTATCATGTCAGTATGATGGCTGACTCTACCTCTAGATGGGCTGAGGCCCTTAGAGAA
                  ************************************************************

HsCD00001924      ATCTCTGGTCGTTTAGCTGAAATGCCTGCAGATAGTGGATATCCAGCCTATCTTGGTGCC
NM_001690.3       ATCTCTGGTCGTTTAGCTGAAATGCCTGCAGATAGTGGATATCCAGCCTATCTTGGTGCC
                  ************************************************************

HsCD00001924      CGTCTGGCCTCGTTTTATGAACGAGCAGGCAGGGTGAAATGTCTTGGAAATCCTGAAAGA
NM_001690.3       CGTCTGGCCTCGTTTTATGAACGAGCAGGCAGGGTGAAATGTCTTGGAAATCCTGAAAGA
                  ************************************************************

HsCD00001924      GAAGGGAGTGTCAGCATTGTAGGAGCAGTTTCTCCACCTGGTGGTGATTTTTCTGATCCA
NM_001690.3       GAAGGGAGTGTCAGCATTGTAGGAGCAGTTTCTCCACCTGGTGGTGATTTTTCTGATCCA
                  ************************************************************

HsCD00001924      GTTACATCTGCCACTCTTGGTATCGTTCAGGTGTTCTGGGGCTTAGATAAGAAACTAGCT
NM_001690.3       GTTACATCTGCCACTCTTGGTATCGTTCAGGTGTTCTGGGGCTTAGATAAGAAACTAGCT
                  ************************************************************

HsCD00001924      CAACGTAAGCATTTCCCCTCTGTCAATTGGCTCATCAGCTACAGCAAGTATATGCGTGCC
NM_001690.3       CAACGTAAGCATTTCCCCTCTGTCAATTGGCTCATCAGCTACAGCAAGTATATGCGTGCC
                  ************************************************************

HsCD00001924      TTGGATGAATACTATGACAAACACTTCACAGAGTTCGTTCCTCTGAGGACGAAAGCTAAG
NM_001690.3       TTGGATGAATACTATGACAAACACTTCACAGAGTTCGTTCCTCTGAGGACGAAAGCTAAG
                  ************************************************************

HsCD00001924      GAAATTCTGCAGGAAGAAGAAGACCTGGCAGAAATTGTACAGCTTGTGGGAAAGGCTTCT
NM_001690.3       GAAATTCTGCAGGAAGAAGAAGACCTGGCAGAAATTGTACAGCTTGTGGGAAAGGCTTCT
                  ************************************************************

HsCD00001924      TTGGCAGAAACAGATAAAATCACTCTGGAGGTAGCAAAACTTATCAAAGATGATTTCCTA
NM_001690.3       TTGGCAGAAACAGATAAAATCACTCTGGAGGTAGCAAAACTTATCAAAGATGATTTCCTA
                  ************************************************************

HsCD00001924      CAACAAAATGGATATACTCCTTATGACAGGTTCTGCCCATTCTACAAGACAGTAGGGATG
NM_001690.3       CAACAAAATGGATATACTCCTTATGACAGGTTCTGCCCATTCTACAAGACAGTAGGGATG
                  ************************************************************

HsCD00001924      CTGTCCAACATGATTGCATTTTATGATATGGCTCGTAGAGCTGTTGAAACCACTGCCCAG
NM_001690.3       CTGTCCAACATGATTGCATTTTATGATATGGCTCGTAGAGCTGTTGAAACCACTGCCCAG
                  ************************************************************

HsCD00001924      AGTGACAATAAAATCACATGGTCCATTATTCGTGAGCACATGGGAGACATCCTCTATAAA
NM_001690.3       AGTGACAATAAAATCACATGGTCCATTATTCGTGAGCACATGGGAGACATCCTCTATAAA
                  ************************************************************

HsCD00001924      CTTTCCTCCATGAAATTCAAGGATCCACTGAAAGATGGTGAGGCAAAGATCAAAAGCGAC
NM_001690.3       CTTTCCTCCATGAAATTCAAGGATCCACTGAAAGATGGTGAGGCAAAGATCAAAAGCGAC
                  ************************************************************

HsCD00001924      TATGCACAACTTCTTGAAGACATGCAGAATGCATTCCGTAGCCTTGAAGATTTG
NM_001690.3       TATGCACAACTTCTTGAAGACATGCAGAATGCATTCCGTAGCCTTGAAGATTAG
                  ****************************************************:*

Pathways

Reactome : Disease
Reactome : Insulin receptor recycling
Reactome : Iron uptake and transport
Reactome : Latent infection of Homo sapiens with Mycobacterium tuberculosis
Reactome : Phagosomal maturation (early endosomal stage)
Reactome : Signal Transduction
Reactome : Signaling by Insulin receptor
Reactome : Transferrin endocytosis and recycling
Reactome : Transmembrane transport of small molecules

Protein

UniProt : P38606
HPRD : 06120

Clone

Cloning Information : 13978
HIP Master Clone ID : 28177
Original Clone ID : FLH013978.01L

Organism


TAX_ID : 9606
Species Specific ID: 523

Genome

Chromosome : 3
Map Location : 3q13.31
Ensembl : ENSG00000114573

Reagents

Labome : ATP6V1A-antibody